ID: 934313571

View in Genome Browser
Species Human (GRCh38)
Location 2:91894325-91894347
Sequence CTGCTTTTGGTGAAGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934313569_934313571 24 Left 934313569 2:91894278-91894300 CCTAGAAACATTCAATGGTCATT No data
Right 934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934313571 Original CRISPR CTGCTTTTGGTGAAGAAAAA AGG Intergenic
No off target data available for this crispr