ID: 934315394

View in Genome Browser
Species Human (GRCh38)
Location 2:91913622-91913644
Sequence CAACATAAACATACAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934315394_934315399 22 Left 934315394 2:91913622-91913644 CCCAGCTCTGTATGTTTATGTTG No data
Right 934315399 2:91913667-91913689 GTTTATTAGGATGGCCAAAAAGG No data
934315394_934315396 9 Left 934315394 2:91913622-91913644 CCCAGCTCTGTATGTTTATGTTG No data
Right 934315396 2:91913654-91913676 AGAGCAACCAGTTGTTTATTAGG No data
934315394_934315397 13 Left 934315394 2:91913622-91913644 CCCAGCTCTGTATGTTTATGTTG No data
Right 934315397 2:91913658-91913680 CAACCAGTTGTTTATTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934315394 Original CRISPR CAACATAAACATACAGAGCT GGG (reversed) Intergenic
No off target data available for this crispr