ID: 934320513

View in Genome Browser
Species Human (GRCh38)
Location 2:91967413-91967435
Sequence AAACATGAACAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934320505_934320513 15 Left 934320505 2:91967375-91967397 CCCACTGGCCACTAGCTAGAGAT No data
Right 934320513 2:91967413-91967435 AAACATGAACAAATGGAGCTGGG No data
934320509_934320513 7 Left 934320509 2:91967383-91967405 CCACTAGCTAGAGATGGGTGTAG No data
Right 934320513 2:91967413-91967435 AAACATGAACAAATGGAGCTGGG No data
934320506_934320513 14 Left 934320506 2:91967376-91967398 CCACTGGCCACTAGCTAGAGATG No data
Right 934320513 2:91967413-91967435 AAACATGAACAAATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934320513 Original CRISPR AAACATGAACAAATGGAGCT GGG Intergenic
No off target data available for this crispr