ID: 934321440

View in Genome Browser
Species Human (GRCh38)
Location 2:91974984-91975006
Sequence CCGGCGGTGGCAGCCAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934321429_934321440 26 Left 934321429 2:91974935-91974957 CCGGTGAGTGCGTGAGGGGCTCG No data
Right 934321440 2:91974984-91975006 CCGGCGGTGGCAGCCAGGCCAGG No data
934321434_934321440 1 Left 934321434 2:91974960-91974982 CCGGGAGACTTTCTTTGTGAAAC No data
Right 934321440 2:91974984-91975006 CCGGCGGTGGCAGCCAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934321440 Original CRISPR CCGGCGGTGGCAGCCAGGCC AGG Intergenic
No off target data available for this crispr