ID: 934327465

View in Genome Browser
Species Human (GRCh38)
Location 2:92031815-92031837
Sequence AGGAAGGGAGGACTAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934327465_934327473 10 Left 934327465 2:92031815-92031837 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 934327473 2:92031848-92031870 CTCAAAGGCAAGTCCCCATGAGG No data
934327465_934327479 30 Left 934327465 2:92031815-92031837 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 934327479 2:92031868-92031890 AGGTCATCAGTGCAGGCCGCGGG No data
934327465_934327471 -5 Left 934327465 2:92031815-92031837 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 934327471 2:92031833-92031855 TTCCTGTGTCAACTGCTCAAAGG No data
934327465_934327478 29 Left 934327465 2:92031815-92031837 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 934327478 2:92031867-92031889 GAGGTCATCAGTGCAGGCCGCGG No data
934327465_934327475 23 Left 934327465 2:92031815-92031837 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934327465 Original CRISPR AGGAAGGGAGGACTAGGGCC TGG (reversed) Intergenic