ID: 934327466

View in Genome Browser
Species Human (GRCh38)
Location 2:92031820-92031842
Sequence GACACAGGAAGGGAGGACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934327466_934327471 -10 Left 934327466 2:92031820-92031842 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 934327471 2:92031833-92031855 TTCCTGTGTCAACTGCTCAAAGG No data
934327466_934327479 25 Left 934327466 2:92031820-92031842 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 934327479 2:92031868-92031890 AGGTCATCAGTGCAGGCCGCGGG No data
934327466_934327475 18 Left 934327466 2:92031820-92031842 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data
934327466_934327478 24 Left 934327466 2:92031820-92031842 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 934327478 2:92031867-92031889 GAGGTCATCAGTGCAGGCCGCGG No data
934327466_934327473 5 Left 934327466 2:92031820-92031842 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 934327473 2:92031848-92031870 CTCAAAGGCAAGTCCCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934327466 Original CRISPR GACACAGGAAGGGAGGACTA GGG (reversed) Intergenic