ID: 934327467

View in Genome Browser
Species Human (GRCh38)
Location 2:92031821-92031843
Sequence TGACACAGGAAGGGAGGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934327467_934327473 4 Left 934327467 2:92031821-92031843 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 934327473 2:92031848-92031870 CTCAAAGGCAAGTCCCCATGAGG No data
934327467_934327478 23 Left 934327467 2:92031821-92031843 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 934327478 2:92031867-92031889 GAGGTCATCAGTGCAGGCCGCGG No data
934327467_934327479 24 Left 934327467 2:92031821-92031843 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 934327479 2:92031868-92031890 AGGTCATCAGTGCAGGCCGCGGG No data
934327467_934327475 17 Left 934327467 2:92031821-92031843 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934327467 Original CRISPR TGACACAGGAAGGGAGGACT AGG (reversed) Intergenic