ID: 934327468

View in Genome Browser
Species Human (GRCh38)
Location 2:92031827-92031849
Sequence AGCAGTTGACACAGGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934327468_934327480 26 Left 934327468 2:92031827-92031849 CCTCCCTTCCTGTGTCAACTGCT No data
Right 934327480 2:92031876-92031898 AGTGCAGGCCGCGGGAGAGAAGG No data
934327468_934327478 17 Left 934327468 2:92031827-92031849 CCTCCCTTCCTGTGTCAACTGCT No data
Right 934327478 2:92031867-92031889 GAGGTCATCAGTGCAGGCCGCGG No data
934327468_934327479 18 Left 934327468 2:92031827-92031849 CCTCCCTTCCTGTGTCAACTGCT No data
Right 934327479 2:92031868-92031890 AGGTCATCAGTGCAGGCCGCGGG No data
934327468_934327475 11 Left 934327468 2:92031827-92031849 CCTCCCTTCCTGTGTCAACTGCT No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data
934327468_934327473 -2 Left 934327468 2:92031827-92031849 CCTCCCTTCCTGTGTCAACTGCT No data
Right 934327473 2:92031848-92031870 CTCAAAGGCAAGTCCCCATGAGG No data
934327468_934327481 30 Left 934327468 2:92031827-92031849 CCTCCCTTCCTGTGTCAACTGCT No data
Right 934327481 2:92031880-92031902 CAGGCCGCGGGAGAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934327468 Original CRISPR AGCAGTTGACACAGGAAGGG AGG (reversed) Intergenic