ID: 934327469

View in Genome Browser
Species Human (GRCh38)
Location 2:92031830-92031852
Sequence TTGAGCAGTTGACACAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934327469_934327479 15 Left 934327469 2:92031830-92031852 CCCTTCCTGTGTCAACTGCTCAA No data
Right 934327479 2:92031868-92031890 AGGTCATCAGTGCAGGCCGCGGG No data
934327469_934327475 8 Left 934327469 2:92031830-92031852 CCCTTCCTGTGTCAACTGCTCAA No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data
934327469_934327473 -5 Left 934327469 2:92031830-92031852 CCCTTCCTGTGTCAACTGCTCAA No data
Right 934327473 2:92031848-92031870 CTCAAAGGCAAGTCCCCATGAGG No data
934327469_934327481 27 Left 934327469 2:92031830-92031852 CCCTTCCTGTGTCAACTGCTCAA No data
Right 934327481 2:92031880-92031902 CAGGCCGCGGGAGAGAAGGCAGG No data
934327469_934327478 14 Left 934327469 2:92031830-92031852 CCCTTCCTGTGTCAACTGCTCAA No data
Right 934327478 2:92031867-92031889 GAGGTCATCAGTGCAGGCCGCGG No data
934327469_934327482 28 Left 934327469 2:92031830-92031852 CCCTTCCTGTGTCAACTGCTCAA No data
Right 934327482 2:92031881-92031903 AGGCCGCGGGAGAGAAGGCAGGG No data
934327469_934327480 23 Left 934327469 2:92031830-92031852 CCCTTCCTGTGTCAACTGCTCAA No data
Right 934327480 2:92031876-92031898 AGTGCAGGCCGCGGGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934327469 Original CRISPR TTGAGCAGTTGACACAGGAA GGG (reversed) Intergenic