ID: 934327470

View in Genome Browser
Species Human (GRCh38)
Location 2:92031831-92031853
Sequence TTTGAGCAGTTGACACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934327470_934327478 13 Left 934327470 2:92031831-92031853 CCTTCCTGTGTCAACTGCTCAAA No data
Right 934327478 2:92031867-92031889 GAGGTCATCAGTGCAGGCCGCGG No data
934327470_934327480 22 Left 934327470 2:92031831-92031853 CCTTCCTGTGTCAACTGCTCAAA No data
Right 934327480 2:92031876-92031898 AGTGCAGGCCGCGGGAGAGAAGG No data
934327470_934327481 26 Left 934327470 2:92031831-92031853 CCTTCCTGTGTCAACTGCTCAAA No data
Right 934327481 2:92031880-92031902 CAGGCCGCGGGAGAGAAGGCAGG No data
934327470_934327479 14 Left 934327470 2:92031831-92031853 CCTTCCTGTGTCAACTGCTCAAA No data
Right 934327479 2:92031868-92031890 AGGTCATCAGTGCAGGCCGCGGG No data
934327470_934327475 7 Left 934327470 2:92031831-92031853 CCTTCCTGTGTCAACTGCTCAAA No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data
934327470_934327473 -6 Left 934327470 2:92031831-92031853 CCTTCCTGTGTCAACTGCTCAAA No data
Right 934327473 2:92031848-92031870 CTCAAAGGCAAGTCCCCATGAGG No data
934327470_934327484 30 Left 934327470 2:92031831-92031853 CCTTCCTGTGTCAACTGCTCAAA No data
Right 934327484 2:92031884-92031906 CCGCGGGAGAGAAGGCAGGGTGG No data
934327470_934327482 27 Left 934327470 2:92031831-92031853 CCTTCCTGTGTCAACTGCTCAAA No data
Right 934327482 2:92031881-92031903 AGGCCGCGGGAGAGAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934327470 Original CRISPR TTTGAGCAGTTGACACAGGA AGG (reversed) Intergenic