ID: 934327472

View in Genome Browser
Species Human (GRCh38)
Location 2:92031835-92031857
Sequence TGCCTTTGAGCAGTTGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934327472_934327482 23 Left 934327472 2:92031835-92031857 CCTGTGTCAACTGCTCAAAGGCA No data
Right 934327482 2:92031881-92031903 AGGCCGCGGGAGAGAAGGCAGGG No data
934327472_934327478 9 Left 934327472 2:92031835-92031857 CCTGTGTCAACTGCTCAAAGGCA No data
Right 934327478 2:92031867-92031889 GAGGTCATCAGTGCAGGCCGCGG No data
934327472_934327473 -10 Left 934327472 2:92031835-92031857 CCTGTGTCAACTGCTCAAAGGCA No data
Right 934327473 2:92031848-92031870 CTCAAAGGCAAGTCCCCATGAGG No data
934327472_934327479 10 Left 934327472 2:92031835-92031857 CCTGTGTCAACTGCTCAAAGGCA No data
Right 934327479 2:92031868-92031890 AGGTCATCAGTGCAGGCCGCGGG No data
934327472_934327481 22 Left 934327472 2:92031835-92031857 CCTGTGTCAACTGCTCAAAGGCA No data
Right 934327481 2:92031880-92031902 CAGGCCGCGGGAGAGAAGGCAGG No data
934327472_934327484 26 Left 934327472 2:92031835-92031857 CCTGTGTCAACTGCTCAAAGGCA No data
Right 934327484 2:92031884-92031906 CCGCGGGAGAGAAGGCAGGGTGG No data
934327472_934327485 30 Left 934327472 2:92031835-92031857 CCTGTGTCAACTGCTCAAAGGCA No data
Right 934327485 2:92031888-92031910 GGGAGAGAAGGCAGGGTGGCAGG No data
934327472_934327475 3 Left 934327472 2:92031835-92031857 CCTGTGTCAACTGCTCAAAGGCA No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data
934327472_934327480 18 Left 934327472 2:92031835-92031857 CCTGTGTCAACTGCTCAAAGGCA No data
Right 934327480 2:92031876-92031898 AGTGCAGGCCGCGGGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934327472 Original CRISPR TGCCTTTGAGCAGTTGACAC AGG (reversed) Intergenic