ID: 934327475

View in Genome Browser
Species Human (GRCh38)
Location 2:92031861-92031883
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934327466_934327475 18 Left 934327466 2:92031820-92031842 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data
934327468_934327475 11 Left 934327468 2:92031827-92031849 CCTCCCTTCCTGTGTCAACTGCT No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data
934327469_934327475 8 Left 934327469 2:92031830-92031852 CCCTTCCTGTGTCAACTGCTCAA No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data
934327467_934327475 17 Left 934327467 2:92031821-92031843 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data
934327470_934327475 7 Left 934327470 2:92031831-92031853 CCTTCCTGTGTCAACTGCTCAAA No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data
934327472_934327475 3 Left 934327472 2:92031835-92031857 CCTGTGTCAACTGCTCAAAGGCA No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data
934327465_934327475 23 Left 934327465 2:92031815-92031837 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type