ID: 934327512

View in Genome Browser
Species Human (GRCh38)
Location 2:92032130-92032152
Sequence TGTCCTATACTGGGCTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934327512_934327518 25 Left 934327512 2:92032130-92032152 CCACAAAAGCCCAGTATAGGACA No data
Right 934327518 2:92032178-92032200 GTTAACTGGAGAAGATGACCGGG No data
934327512_934327515 -4 Left 934327512 2:92032130-92032152 CCACAAAAGCCCAGTATAGGACA No data
Right 934327515 2:92032149-92032171 GACAAGAGCTGTCTCTCAAAAGG No data
934327512_934327517 24 Left 934327512 2:92032130-92032152 CCACAAAAGCCCAGTATAGGACA No data
Right 934327517 2:92032177-92032199 AGTTAACTGGAGAAGATGACCGG No data
934327512_934327516 11 Left 934327512 2:92032130-92032152 CCACAAAAGCCCAGTATAGGACA No data
Right 934327516 2:92032164-92032186 TCAAAAGGAGAGTAGTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934327512 Original CRISPR TGTCCTATACTGGGCTTTTG TGG (reversed) Intergenic
No off target data available for this crispr