ID: 934327513

View in Genome Browser
Species Human (GRCh38)
Location 2:92032139-92032161
Sequence GACAGCTCTTGTCCTATACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934327513_934327518 16 Left 934327513 2:92032139-92032161 CCCAGTATAGGACAAGAGCTGTC No data
Right 934327518 2:92032178-92032200 GTTAACTGGAGAAGATGACCGGG No data
934327513_934327516 2 Left 934327513 2:92032139-92032161 CCCAGTATAGGACAAGAGCTGTC No data
Right 934327516 2:92032164-92032186 TCAAAAGGAGAGTAGTTAACTGG No data
934327513_934327517 15 Left 934327513 2:92032139-92032161 CCCAGTATAGGACAAGAGCTGTC No data
Right 934327517 2:92032177-92032199 AGTTAACTGGAGAAGATGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934327513 Original CRISPR GACAGCTCTTGTCCTATACT GGG (reversed) Intergenic
No off target data available for this crispr