ID: 934327518

View in Genome Browser
Species Human (GRCh38)
Location 2:92032178-92032200
Sequence GTTAACTGGAGAAGATGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934327514_934327518 15 Left 934327514 2:92032140-92032162 CCAGTATAGGACAAGAGCTGTCT No data
Right 934327518 2:92032178-92032200 GTTAACTGGAGAAGATGACCGGG No data
934327512_934327518 25 Left 934327512 2:92032130-92032152 CCACAAAAGCCCAGTATAGGACA No data
Right 934327518 2:92032178-92032200 GTTAACTGGAGAAGATGACCGGG No data
934327513_934327518 16 Left 934327513 2:92032139-92032161 CCCAGTATAGGACAAGAGCTGTC No data
Right 934327518 2:92032178-92032200 GTTAACTGGAGAAGATGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934327518 Original CRISPR GTTAACTGGAGAAGATGACC GGG Intergenic
No off target data available for this crispr