ID: 934328677

View in Genome Browser
Species Human (GRCh38)
Location 2:92042384-92042406
Sequence CCGCGGCACGGTGGGCGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934328666_934328677 -9 Left 934328666 2:92042370-92042392 CCGCCGGTAAATAACCGCGGCAC No data
Right 934328677 2:92042384-92042406 CCGCGGCACGGTGGGCGGGGGGG No data
934328662_934328677 18 Left 934328662 2:92042343-92042365 CCGCGGCGGCGGGGGTGCAAAGA No data
Right 934328677 2:92042384-92042406 CCGCGGCACGGTGGGCGGGGGGG No data
934328664_934328677 -6 Left 934328664 2:92042367-92042389 CCGCCGCCGGTAAATAACCGCGG No data
Right 934328677 2:92042384-92042406 CCGCGGCACGGTGGGCGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934328677 Original CRISPR CCGCGGCACGGTGGGCGGGG GGG Intergenic
No off target data available for this crispr