ID: 934328943

View in Genome Browser
Species Human (GRCh38)
Location 2:92043359-92043381
Sequence CGGCAAAAAGCTGCGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934328939_934328943 -10 Left 934328939 2:92043346-92043368 CCGCGGCGGCGGGCGGCAAAAAG No data
Right 934328943 2:92043359-92043381 CGGCAAAAAGCTGCGGTGGTGGG No data
934328933_934328943 13 Left 934328933 2:92043323-92043345 CCGCGGCGATGGGGGGCAATAAG No data
Right 934328943 2:92043359-92043381 CGGCAAAAAGCTGCGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934328943 Original CRISPR CGGCAAAAAGCTGCGGTGGT GGG Intergenic
No off target data available for this crispr