ID: 934331661

View in Genome Browser
Species Human (GRCh38)
Location 2:92074448-92074470
Sequence CCGCAAAAAGCAGCGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934331661_934331666 0 Left 934331661 2:92074448-92074470 CCCACCACCGCTGCTTTTTGCGG No data
Right 934331666 2:92074471-92074493 CTTTTTGCCCCCTGCCGCCACGG No data
934331661_934331673 22 Left 934331661 2:92074448-92074470 CCCACCACCGCTGCTTTTTGCGG No data
Right 934331673 2:92074493-92074515 GCTTTTTGCCCCTGCCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934331661 Original CRISPR CCGCAAAAAGCAGCGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr