ID: 934332600

View in Genome Browser
Species Human (GRCh38)
Location 2:92084586-92084608
Sequence CCAACGGATATTTGCATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934332596_934332600 19 Left 934332596 2:92084544-92084566 CCATTTGATGATGACTTGGTTTG No data
Right 934332600 2:92084586-92084608 CCAACGGATATTTGCATAGTTGG No data
934332594_934332600 29 Left 934332594 2:92084534-92084556 CCATTCGATTCCATTTGATGATG No data
Right 934332600 2:92084586-92084608 CCAACGGATATTTGCATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934332600 Original CRISPR CCAACGGATATTTGCATAGT TGG Intergenic
No off target data available for this crispr