ID: 934339637

View in Genome Browser
Species Human (GRCh38)
Location 2:92244131-92244153
Sequence AATATCTGCAAGAGTATATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934339636_934339637 17 Left 934339636 2:92244091-92244113 CCTTTCTTTTGATAGAGCAGTTT No data
Right 934339637 2:92244131-92244153 AATATCTGCAAGAGTATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934339637 Original CRISPR AATATCTGCAAGAGTATATT TGG Intergenic
No off target data available for this crispr