ID: 934348362

View in Genome Browser
Species Human (GRCh38)
Location 2:92382667-92382689
Sequence AATATCTGCAAGAGTATATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934348361_934348362 17 Left 934348361 2:92382627-92382649 CCTTTCTTTTGATAGAGCAGTTT No data
Right 934348362 2:92382667-92382689 AATATCTGCAAGAGTATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934348362 Original CRISPR AATATCTGCAAGAGTATATT TGG Intergenic
No off target data available for this crispr