ID: 934372390

View in Genome Browser
Species Human (GRCh38)
Location 2:92765145-92765167
Sequence AATATCTGCAAGAGGATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934372388_934372390 17 Left 934372388 2:92765105-92765127 CCTTTCTTTTGATAGAGCAGTTT No data
Right 934372390 2:92765145-92765167 AATATCTGCAAGAGGATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934372390 Original CRISPR AATATCTGCAAGAGGATAGT TGG Intergenic
No off target data available for this crispr