ID: 934419804

View in Genome Browser
Species Human (GRCh38)
Location 2:93528943-93528965
Sequence AATATCTGCAAGAGTATATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934419803_934419804 17 Left 934419803 2:93528903-93528925 CCTTTCTTTTGATAGAGCAGTTT No data
Right 934419804 2:93528943-93528965 AATATCTGCAAGAGTATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934419804 Original CRISPR AATATCTGCAAGAGTATATT TGG Intergenic
No off target data available for this crispr