ID: 934443836

View in Genome Browser
Species Human (GRCh38)
Location 2:93916139-93916161
Sequence AATATCTGCAAGAGTATATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934443835_934443836 17 Left 934443835 2:93916099-93916121 CCTTTCTTTTGATAGAGCAGTTT No data
Right 934443836 2:93916139-93916161 AATATCTGCAAGAGTATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934443836 Original CRISPR AATATCTGCAAGAGTATATT TGG Intergenic
No off target data available for this crispr