ID: 934460505 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:94211863-94211885 |
Sequence | CCTGGCACGGAGCAGCTGGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
934460505_934460516 | 28 | Left | 934460505 | 2:94211863-94211885 | CCACCCAGCTGCTCCGTGCCAGG | No data | ||
Right | 934460516 | 2:94211914-94211936 | CACCACGGCTCGCCTCGCTGCGG | No data | ||||
934460505_934460517 | 29 | Left | 934460505 | 2:94211863-94211885 | CCACCCAGCTGCTCCGTGCCAGG | No data | ||
Right | 934460517 | 2:94211915-94211937 | ACCACGGCTCGCCTCGCTGCGGG | No data | ||||
934460505_934460514 | 13 | Left | 934460505 | 2:94211863-94211885 | CCACCCAGCTGCTCCGTGCCAGG | No data | ||
Right | 934460514 | 2:94211899-94211921 | ACCTAGAGCGTGCAACACCACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
934460505 | Original CRISPR | CCTGGCACGGAGCAGCTGGG TGG (reversed) | Intergenic | ||
No off target data available for this crispr |