ID: 934460505

View in Genome Browser
Species Human (GRCh38)
Location 2:94211863-94211885
Sequence CCTGGCACGGAGCAGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934460505_934460516 28 Left 934460505 2:94211863-94211885 CCACCCAGCTGCTCCGTGCCAGG No data
Right 934460516 2:94211914-94211936 CACCACGGCTCGCCTCGCTGCGG No data
934460505_934460517 29 Left 934460505 2:94211863-94211885 CCACCCAGCTGCTCCGTGCCAGG No data
Right 934460517 2:94211915-94211937 ACCACGGCTCGCCTCGCTGCGGG No data
934460505_934460514 13 Left 934460505 2:94211863-94211885 CCACCCAGCTGCTCCGTGCCAGG No data
Right 934460514 2:94211899-94211921 ACCTAGAGCGTGCAACACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934460505 Original CRISPR CCTGGCACGGAGCAGCTGGG TGG (reversed) Intergenic
No off target data available for this crispr