ID: 934461669

View in Genome Browser
Species Human (GRCh38)
Location 2:94216351-94216373
Sequence CTCTGGCCCTGCCTTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934461669_934461675 -2 Left 934461669 2:94216351-94216373 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 934461675 2:94216372-94216394 AGCTGGACTTGGAGGTGTCCTGG No data
934461669_934461677 24 Left 934461669 2:94216351-94216373 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 934461677 2:94216398-94216420 GATTTGCCCTGCCCCAACGTTGG No data
934461669_934461673 -10 Left 934461669 2:94216351-94216373 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 934461673 2:94216364-94216386 AGGGCCAGAGCTGGACTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934461669 Original CRISPR CTCTGGCCCTGCCTTGGCCC TGG (reversed) Intergenic
No off target data available for this crispr