ID: 934461674

View in Genome Browser
Species Human (GRCh38)
Location 2:94216368-94216390
Sequence GACACCTCCAAGTCCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934461674_934461677 7 Left 934461674 2:94216368-94216390 CCAGAGCTGGACTTGGAGGTGTC No data
Right 934461677 2:94216398-94216420 GATTTGCCCTGCCCCAACGTTGG No data
934461674_934461683 23 Left 934461674 2:94216368-94216390 CCAGAGCTGGACTTGGAGGTGTC No data
Right 934461683 2:94216414-94216436 ACGTTGGCCCAGCCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934461674 Original CRISPR GACACCTCCAAGTCCAGCTC TGG (reversed) Intergenic
No off target data available for this crispr