ID: 934461677

View in Genome Browser
Species Human (GRCh38)
Location 2:94216398-94216420
Sequence GATTTGCCCTGCCCCAACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934461674_934461677 7 Left 934461674 2:94216368-94216390 CCAGAGCTGGACTTGGAGGTGTC No data
Right 934461677 2:94216398-94216420 GATTTGCCCTGCCCCAACGTTGG No data
934461671_934461677 18 Left 934461671 2:94216357-94216379 CCAAGGCAGGGCCAGAGCTGGAC No data
Right 934461677 2:94216398-94216420 GATTTGCCCTGCCCCAACGTTGG No data
934461669_934461677 24 Left 934461669 2:94216351-94216373 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 934461677 2:94216398-94216420 GATTTGCCCTGCCCCAACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934461677 Original CRISPR GATTTGCCCTGCCCCAACGT TGG Intergenic
No off target data available for this crispr