ID: 934461677 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:94216398-94216420 |
| Sequence | GATTTGCCCTGCCCCAACGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 934461674_934461677 | 7 | Left | 934461674 | 2:94216368-94216390 | CCAGAGCTGGACTTGGAGGTGTC | No data | ||
| Right | 934461677 | 2:94216398-94216420 | GATTTGCCCTGCCCCAACGTTGG | No data | ||||
| 934461671_934461677 | 18 | Left | 934461671 | 2:94216357-94216379 | CCAAGGCAGGGCCAGAGCTGGAC | No data | ||
| Right | 934461677 | 2:94216398-94216420 | GATTTGCCCTGCCCCAACGTTGG | No data | ||||
| 934461669_934461677 | 24 | Left | 934461669 | 2:94216351-94216373 | CCAGGGCCAAGGCAGGGCCAGAG | No data | ||
| Right | 934461677 | 2:94216398-94216420 | GATTTGCCCTGCCCCAACGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 934461677 | Original CRISPR | GATTTGCCCTGCCCCAACGT TGG | Intergenic | ||