ID: 934461683

View in Genome Browser
Species Human (GRCh38)
Location 2:94216414-94216436
Sequence ACGTTGGCCCAGCCCTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934461674_934461683 23 Left 934461674 2:94216368-94216390 CCAGAGCTGGACTTGGAGGTGTC No data
Right 934461683 2:94216414-94216436 ACGTTGGCCCAGCCCTGCTCTGG No data
934461676_934461683 1 Left 934461676 2:94216390-94216412 CCTGGTCTGATTTGCCCTGCCCC No data
Right 934461683 2:94216414-94216436 ACGTTGGCCCAGCCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934461683 Original CRISPR ACGTTGGCCCAGCCCTGCTC TGG Intergenic
No off target data available for this crispr