ID: 934465539

View in Genome Browser
Species Human (GRCh38)
Location 2:94259835-94259857
Sequence GCCATGGAGTCCAATGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934465539 Original CRISPR GCCATGGAGTCCAATGTTTG AGG (reversed) Intergenic