ID: 934465862

View in Genome Browser
Species Human (GRCh38)
Location 2:94262441-94262463
Sequence CCCCATGAGGTCATCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934465854_934465862 17 Left 934465854 2:94262401-94262423 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 934465862 2:94262441-94262463 CCCCATGAGGTCATCAGTGCAGG No data
934465856_934465862 8 Left 934465856 2:94262410-94262432 CCCTTCCTGTGTCAACTGCTCAA No data
Right 934465862 2:94262441-94262463 CCCCATGAGGTCATCAGTGCAGG No data
934465855_934465862 11 Left 934465855 2:94262407-94262429 CCTCCCTTCCTGTGTCAACTGCT No data
Right 934465862 2:94262441-94262463 CCCCATGAGGTCATCAGTGCAGG No data
934465853_934465862 18 Left 934465853 2:94262400-94262422 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 934465862 2:94262441-94262463 CCCCATGAGGTCATCAGTGCAGG No data
934465857_934465862 7 Left 934465857 2:94262411-94262433 CCTTCCTGTGTCAACTGCTCAAA No data
Right 934465862 2:94262441-94262463 CCCCATGAGGTCATCAGTGCAGG No data
934465852_934465862 23 Left 934465852 2:94262395-94262417 CCGGGCCCTAGTCCTCCCTTCCT No data
Right 934465862 2:94262441-94262463 CCCCATGAGGTCATCAGTGCAGG No data
934465859_934465862 3 Left 934465859 2:94262415-94262437 CCTGTGTCAACTGCTCAAAGGCA No data
Right 934465862 2:94262441-94262463 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934465862 Original CRISPR CCCCATGAGGTCATCAGTGC AGG Intergenic
No off target data available for this crispr