ID: 934465906

View in Genome Browser
Species Human (GRCh38)
Location 2:94262756-94262778
Sequence AGTTAACTGGAGAAGATGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934465903_934465906 14 Left 934465903 2:94262719-94262741 CCAGTATAGGACAAGAGCTGTCT No data
Right 934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG No data
934465901_934465906 24 Left 934465901 2:94262709-94262731 CCACAAAAGCCCAGTATAGGACA No data
Right 934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG No data
934465902_934465906 15 Left 934465902 2:94262718-94262740 CCCAGTATAGGACAAGAGCTGTC No data
Right 934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934465906 Original CRISPR AGTTAACTGGAGAAGATGAC CGG Intergenic
No off target data available for this crispr