ID: 934480615

View in Genome Browser
Species Human (GRCh38)
Location 2:94638861-94638883
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934480615_934480618 19 Left 934480615 2:94638861-94638883 CCCTCACCATTGAAAACACATTA No data
Right 934480618 2:94638903-94638925 TCATTTCCACACAAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934480615 Original CRISPR TAATGTGTTTTCAATGGTGA GGG (reversed) Intergenic
No off target data available for this crispr