ID: 934480617

View in Genome Browser
Species Human (GRCh38)
Location 2:94638867-94638889
Sequence GTCAGTTAATGTGTTTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934480617_934480618 13 Left 934480617 2:94638867-94638889 CCATTGAAAACACATTAACTGAC No data
Right 934480618 2:94638903-94638925 TCATTTCCACACAAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934480617 Original CRISPR GTCAGTTAATGTGTTTTCAA TGG (reversed) Intergenic
No off target data available for this crispr