ID: 934480618

View in Genome Browser
Species Human (GRCh38)
Location 2:94638903-94638925
Sequence TCATTTCCACACAAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934480614_934480618 20 Left 934480614 2:94638860-94638882 CCCCTCACCATTGAAAACACATT No data
Right 934480618 2:94638903-94638925 TCATTTCCACACAAAGAAGATGG No data
934480617_934480618 13 Left 934480617 2:94638867-94638889 CCATTGAAAACACATTAACTGAC No data
Right 934480618 2:94638903-94638925 TCATTTCCACACAAAGAAGATGG No data
934480616_934480618 18 Left 934480616 2:94638862-94638884 CCTCACCATTGAAAACACATTAA No data
Right 934480618 2:94638903-94638925 TCATTTCCACACAAAGAAGATGG No data
934480615_934480618 19 Left 934480615 2:94638861-94638883 CCCTCACCATTGAAAACACATTA No data
Right 934480618 2:94638903-94638925 TCATTTCCACACAAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934480618 Original CRISPR TCATTTCCACACAAAGAAGA TGG Intergenic
No off target data available for this crispr