ID: 934484794

View in Genome Browser
Species Human (GRCh38)
Location 2:94695637-94695659
Sequence TTGGAGACTCAGAGCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934484786_934484794 17 Left 934484786 2:94695597-94695619 CCTTGGTTATGCAAAGTCATACA No data
Right 934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934484794 Original CRISPR TTGGAGACTCAGAGCGGGGA GGG Intergenic
No off target data available for this crispr