ID: 934490816

View in Genome Browser
Species Human (GRCh38)
Location 2:94761124-94761146
Sequence AGGGAGTCCCATTTCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934490816_934490821 19 Left 934490816 2:94761124-94761146 CCACACCTGAAATGGGACTCCCT No data
Right 934490821 2:94761166-94761188 CTACAGATGGAAGAATGCTCTGG No data
934490816_934490820 6 Left 934490816 2:94761124-94761146 CCACACCTGAAATGGGACTCCCT No data
Right 934490820 2:94761153-94761175 GCAGCTGAAACATCTACAGATGG No data
934490816_934490822 28 Left 934490816 2:94761124-94761146 CCACACCTGAAATGGGACTCCCT No data
Right 934490822 2:94761175-94761197 GAAGAATGCTCTGGTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934490816 Original CRISPR AGGGAGTCCCATTTCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr