ID: 934492365

View in Genome Browser
Species Human (GRCh38)
Location 2:94770267-94770289
Sequence ATGTAGAAGCAGATTCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934492365_934492368 11 Left 934492365 2:94770267-94770289 CCCTTCTGAATCTGCTTCTACAT No data
Right 934492368 2:94770301-94770323 TTTGCCGCAGCCTGGCAGTGTGG No data
934492365_934492367 3 Left 934492365 2:94770267-94770289 CCCTTCTGAATCTGCTTCTACAT No data
Right 934492367 2:94770293-94770315 CAGCTATCTTTGCCGCAGCCTGG No data
934492365_934492370 17 Left 934492365 2:94770267-94770289 CCCTTCTGAATCTGCTTCTACAT No data
Right 934492370 2:94770307-94770329 GCAGCCTGGCAGTGTGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934492365 Original CRISPR ATGTAGAAGCAGATTCAGAA GGG (reversed) Intergenic
No off target data available for this crispr