ID: 934501298

View in Genome Browser
Species Human (GRCh38)
Location 2:94862042-94862064
Sequence TGGCCAGAAGCTCTGGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 8, 3: 37, 4: 349}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934501298_934501305 14 Left 934501298 2:94862042-94862064 CCGCAGGCCAGAGCTTCTGGCCA 0: 1
1: 0
2: 8
3: 37
4: 349
Right 934501305 2:94862079-94862101 CCCAAGGAGCCTCCGCTGCCCGG 0: 1
1: 1
2: 7
3: 23
4: 231
934501298_934501310 30 Left 934501298 2:94862042-94862064 CCGCAGGCCAGAGCTTCTGGCCA 0: 1
1: 0
2: 8
3: 37
4: 349
Right 934501310 2:94862095-94862117 TGCCCGGGAACAGCAAAGCCAGG 0: 1
1: 0
2: 4
3: 14
4: 148
934501298_934501302 -2 Left 934501298 2:94862042-94862064 CCGCAGGCCAGAGCTTCTGGCCA 0: 1
1: 0
2: 8
3: 37
4: 349
Right 934501302 2:94862063-94862085 CATGCTGGTCAACTTCCCCAAGG 0: 1
1: 0
2: 2
3: 16
4: 175
934501298_934501307 15 Left 934501298 2:94862042-94862064 CCGCAGGCCAGAGCTTCTGGCCA 0: 1
1: 0
2: 8
3: 37
4: 349
Right 934501307 2:94862080-94862102 CCAAGGAGCCTCCGCTGCCCGGG 0: 1
1: 0
2: 4
3: 38
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934501298 Original CRISPR TGGCCAGAAGCTCTGGCCTG CGG (reversed) Intergenic
900154023 1:1196922-1196944 GGGTCTGAAGCTCTGGCCTGAGG - Intronic
901975559 1:12941485-12941507 TGGTCTGAAGCTATGGCCCGTGG - Exonic
901983157 1:13052619-13052641 TGGTCTGAAGCTATGGCCCGTGG - Intronic
901985858 1:13074717-13074739 TGGTCTGAAGCTATGGCCCGTGG + Exonic
901995951 1:13152050-13152072 TGGTCTGAAGCTATGGCCCGTGG - Intergenic
901998932 1:13176299-13176321 TGGTCTGAAGCTATGGCCCGTGG + Intergenic
902398516 1:16145100-16145122 TGGCCAGCAGCCTTGGCCAGTGG - Intronic
902717768 1:18284161-18284183 TGGACTCAAGCTCTAGCCTGAGG + Intronic
902984587 1:20147999-20148021 AGGTCAGCAGCTCTGGGCTGGGG - Intronic
903368037 1:22816860-22816882 TGGCCAGGAGACCTGGACTGAGG - Intronic
903875210 1:26469260-26469282 TGGCCAGCAAACCTGGCCTGGGG - Exonic
904249541 1:29213235-29213257 TGGCCCGAAGCACTGGCATCAGG + Intronic
905369704 1:37476520-37476542 TGGCCTGATGCTCTGGCCTCAGG + Intronic
905397677 1:37677552-37677574 AGACCAGAATCTCTGGGCTGGGG + Intergenic
906320543 1:44812997-44813019 TGGCCGTAACCTTTGGCCTGGGG + Exonic
906332162 1:44895219-44895241 TGGCCAGAAGCTCTGCCAAATGG - Intronic
906945348 1:50290043-50290065 AGGCCACAGGCTCTGGGCTGGGG - Intergenic
907297804 1:53466664-53466686 TGGCCAGGAGGGCGGGCCTGGGG - Exonic
911401344 1:97379119-97379141 TAGCCAGAGGCTCAGGACTGAGG + Intronic
912502154 1:110129846-110129868 TAGCCAGATGCTCTGGGCAGGGG + Intergenic
914849234 1:151301867-151301889 AGGCCAGAAGCTCTTGCCGAAGG + Exonic
915094054 1:153446630-153446652 TGGCCAGAAGCCTTGTTCTGAGG + Intergenic
916679324 1:167089713-167089735 TGGCAAGGAGCTTTGGCCTTTGG + Intronic
916812478 1:168317617-168317639 TGACCAGTTGCTCTGGCCTCCGG - Intergenic
916962671 1:169904966-169904988 TTGCCAGAAGCTGTGGGGTGGGG + Intergenic
920255763 1:204653005-204653027 TCCGCAGAAGCTCTGACCTGAGG - Intronic
920452422 1:206069595-206069617 TGACCAGCAGCCCAGGCCTGAGG - Intronic
921222197 1:212981167-212981189 TGGCCAGAGTCTCCTGCCTGGGG + Intronic
922106666 1:222518347-222518369 GGGCCTGGAGCCCTGGCCTGGGG - Intergenic
923091936 1:230747567-230747589 TTGCTCAAAGCTCTGGCCTGAGG - Exonic
923848248 1:237762219-237762241 TGGCCTAAGGTTCTGGCCTGAGG + Intronic
924244792 1:242073671-242073693 AGGCCAGAAGCTTAGGACTGTGG + Intergenic
924623750 1:245684159-245684181 AGGCCTGAAGCCCTGCCCTGAGG + Intronic
1063284579 10:4671654-4671676 TGGCCATAAGCTCTCACCTCTGG - Intergenic
1064124631 10:12649367-12649389 TGGCCAGGAGCTGTGTGCTGGGG + Intronic
1064317750 10:14274194-14274216 TGGCCATCATCTCAGGCCTGGGG + Intronic
1067078078 10:43199285-43199307 TGGCCAGAAGCTAAGTCCCGAGG - Intronic
1067283016 10:44887185-44887207 GGGCCAGAAGCTGTTTCCTGTGG - Intergenic
1069563492 10:69448407-69448429 TAGCCAGGAACTCTGGCCTAGGG - Intergenic
1069624007 10:69856010-69856032 GGGCCAGAAGTTCTGGGCTGTGG + Intronic
1071572684 10:86706637-86706659 TGGGCAGCAGCTGTGGCCAGGGG - Intronic
1071731415 10:88252484-88252506 TGGGCAGAGGCTGTGGCCAGAGG + Intergenic
1072912110 10:99511708-99511730 TGGCCAGGAGCTGGGGACTGGGG + Intergenic
1072981203 10:100099261-100099283 TGGCCATAAGTTCTAGCCTATGG - Intergenic
1074055836 10:109922651-109922673 TGGCCAGGGAGTCTGGCCTGTGG + Intronic
1074592986 10:114831443-114831465 GTGCCACATGCTCTGGCCTGAGG - Intronic
1074714662 10:116207192-116207214 TGGCCAGGTGCTTTGGCCTCTGG - Intronic
1075906112 10:126083391-126083413 TGCCCAGAGGCCCTGCCCTGGGG - Intronic
1076462594 10:130656769-130656791 TGGTCAGAAGCGCTTGCATGGGG + Intergenic
1076538468 10:131198403-131198425 GGGCCAGACGCTCTGTCTTGAGG - Intronic
1076750311 10:132538925-132538947 GGGCCATAAGCTGGGGCCTGAGG - Intronic
1076909923 10:133381975-133381997 TGGTCTGAAGGTCAGGCCTGGGG + Intronic
1077103584 11:832671-832693 TAGCCAGAGGCCCTGGGCTGTGG - Intergenic
1077295029 11:1822501-1822523 AGGACAGAAGCTGGGGCCTGTGG + Intergenic
1077529420 11:3088178-3088200 CGGCCAGGAGCTCTGCCCTCAGG + Exonic
1078463830 11:11535637-11535659 TGGTCAGAAGGTCTGGCCAACGG - Intronic
1079073115 11:17365448-17365470 TGGCCTGAGCCTCTGGACTGTGG + Intronic
1079349104 11:19677730-19677752 TGGCCAGCTGATTTGGCCTGGGG - Intronic
1080744547 11:35097055-35097077 TGGCCAGAAGCTCTGGGTGCAGG + Intergenic
1081672356 11:44949451-44949473 TGGCCAGCCGCTCTGGGCTTTGG + Intronic
1082203025 11:49396854-49396876 TGGCCTGAGTCTCTTGCCTGGGG + Intergenic
1082649619 11:55773213-55773235 TGAACAGAAGCTCTGGGATGAGG - Intergenic
1083259231 11:61514242-61514264 TGAACAGAAGCTCTGGCCAAGGG + Intergenic
1083369795 11:62169474-62169496 TGGCCAGAAGCTCAGGCCCCAGG + Intergenic
1084269727 11:68022493-68022515 TGGCCTAGAGCCCTGGCCTGTGG + Intronic
1084542824 11:69798072-69798094 TGGCTTTTAGCTCTGGCCTGCGG + Intergenic
1085537504 11:77232031-77232053 AGGTCAGAAGCTCAGGCCAGAGG + Intronic
1086652010 11:89303225-89303247 TGGCCTGAGTCTCTTGCCTGGGG - Intergenic
1088843611 11:113647013-113647035 TGGCCAGTATCTCTTCCCTGAGG - Intergenic
1089197973 11:116706300-116706322 GGGCCAGATGCTTTGGCCTCTGG - Intergenic
1089320905 11:117626124-117626146 TGGCCTGGAGCTCTGGTATGAGG - Intronic
1090349464 11:126098301-126098323 TGGGCAGAGGCTCTGGAGTGAGG + Intergenic
1091099159 11:132854245-132854267 GGGCCAGAAGCTCTGGCACTTGG - Intronic
1091448578 12:558929-558951 GTGCCAGATGCTCTGCCCTGTGG + Intronic
1091460986 12:643206-643228 GGGCCAGAAGAACGGGCCTGGGG - Intronic
1091688589 12:2580766-2580788 TGGGCAGGAGCTCGGTCCTGAGG - Intronic
1092050334 12:5465133-5465155 TGGGGAGAAGCCCTGGACTGAGG - Intronic
1092824036 12:12380472-12380494 TGTCCAGAAAAGCTGGCCTGTGG - Intronic
1093748525 12:22771693-22771715 TGGCCCTAGTCTCTGGCCTGAGG - Intergenic
1093919491 12:24844005-24844027 GAGCCAGAAGCTCTGACCAGAGG + Intronic
1094835607 12:34320664-34320686 TTCCCAGCAGCTCTGGCGTGGGG - Intergenic
1095942949 12:47738262-47738284 GGGGCATAAGCTCTTGCCTGAGG + Intronic
1096241724 12:49963287-49963309 AGGCTTGAAGCTCAGGCCTGTGG - Intronic
1096816211 12:54203486-54203508 TGGACAGCAGATCTGGCCTGGGG + Intergenic
1101449640 12:104764390-104764412 TGGCCAGTGGCTATGGCCTCTGG + Intergenic
1102581945 12:113894938-113894960 TGGCCAGAAGAGCAGGCTTGGGG - Intronic
1103622976 12:122200207-122200229 TGCCCACAAGCCCTGGGCTGAGG + Exonic
1103724374 12:122990472-122990494 TGGCCAGCAGCTGTCCCCTGTGG + Intronic
1104743355 12:131194651-131194673 TGACCAGTAGGTCTGGGCTGGGG - Intergenic
1107560699 13:41554612-41554634 TGGTCAGGAGCTCAGGCCAGCGG + Intergenic
1112746872 13:102536664-102536686 TGGCCAGAAGTTCGTGCCAGGGG - Intergenic
1113381950 13:109812559-109812581 TTGCCGGAGGCTCTCGCCTGCGG + Intergenic
1113773687 13:112929693-112929715 TGCCCAGAACCTCCGGCCTCGGG + Intronic
1113807675 13:113119007-113119029 AGCCCAGCAGCCCTGGCCTGTGG + Exonic
1113911648 13:113844130-113844152 TGGCCGGAGCTTCTGGCCTGGGG + Intronic
1114518857 14:23320698-23320720 TGACTAGTAGCTCTGGACTGAGG + Intronic
1114650284 14:24280360-24280382 TGAGCAGAAGCCCTGGCTTGGGG + Intergenic
1116069545 14:40026205-40026227 TGGCCAGAAGGCCTGGCCTCTGG + Intergenic
1117011321 14:51473430-51473452 TGGTCAGAAGCTGTGACCTCTGG - Intergenic
1117518407 14:56525763-56525785 TTCCCAAAAGCTCTGGCATGAGG - Intronic
1118966831 14:70594919-70594941 TGGCCCCAATCTCTGACCTGGGG - Intronic
1119203554 14:72777090-72777112 TGAAGAGAAGCCCTGGCCTGTGG + Intronic
1119780109 14:77271492-77271514 TGGCCTGCAGGTCAGGCCTGGGG + Intergenic
1119981964 14:79091726-79091748 TGGGCAGAAGCCCTGTCTTGGGG - Intronic
1122187584 14:100013068-100013090 TGGCTAGAAGGTGAGGCCTGAGG - Intronic
1122187601 14:100013141-100013163 TGGCTAGAAGGTGAGGCCTGAGG - Intronic
1122326129 14:100881632-100881654 TGGCCAGCAGCTCTTGCCGTAGG + Exonic
1122521562 14:102347621-102347643 TGGCCAAAAGCTAGGGCATGGGG - Intronic
1122967335 14:105137549-105137571 AGGCTAGAAGGTGTGGCCTGTGG - Intergenic
1124367181 15:29080414-29080436 AGGCCAGGAGCTCTGGCATCTGG - Intronic
1127530124 15:59835500-59835522 AGGCCAGAAGCTCTGGGTTCTGG + Intergenic
1128692453 15:69735400-69735422 GGGCCGGGAGCTCTGGGCTGTGG - Intergenic
1129359566 15:75016226-75016248 TGGGCAGAAGCTCTGGGTTCTGG + Intronic
1129604083 15:77016340-77016362 CCGCCAGGAGCTCTGACCTGAGG + Intronic
1129663247 15:77565045-77565067 CTGCCAGAGGCTCTGGGCTGAGG - Intergenic
1129999802 15:80036578-80036600 TGGCCAGCTGGTTTGGCCTGTGG - Intergenic
1131244675 15:90780515-90780537 TGGCCAGAATTTCTTGTCTGTGG + Intronic
1132497197 16:269459-269481 TGGCCGGCGGCTGTGGCCTGGGG - Intronic
1133998862 16:10767138-10767160 TCGCCAGCAGCTCAGGCCTGGGG + Exonic
1136274948 16:29173987-29174009 TTACCAGATCCTCTGGCCTGGGG - Intergenic
1136494723 16:30635374-30635396 TGGCCAGACGCTATGGCCCAGGG + Intergenic
1136856825 16:33665771-33665793 CTGCCAGAGGCTCTGCCCTGAGG - Intergenic
1137023884 16:35454824-35454846 TGGCCAGAAGTACTGGTTTGGGG - Intergenic
1137028554 16:35501401-35501423 TGGCCAGAAGTACTGGGGTGGGG - Intergenic
1137263777 16:46852216-46852238 TGTGCAGGAGCTCTGGCCTACGG + Intergenic
1137290656 16:47049972-47049994 TGGCCAGGAGGTCTGGCTTCTGG - Intergenic
1140472944 16:75225191-75225213 TGGCAAGAACCTGTCGCCTGGGG - Intergenic
1141419474 16:83903490-83903512 TGTCCAGAAGCCCTGCTCTGGGG - Intronic
1142065218 16:88058497-88058519 TCCCCCGAAGCTCTGGTCTGTGG - Intronic
1142079262 16:88139868-88139890 TTACCAGATCCTCTGGCCTGGGG - Intergenic
1203118398 16_KI270728v1_random:1514246-1514268 CTGCCAGAGGCTCTGCCCTGAGG - Intergenic
1143660516 17:8321905-8321927 TGGCCAGTAGCTGGGTCCTGAGG + Exonic
1143751675 17:9032703-9032725 TGTCCAACAGCTCTGCCCTGGGG - Intronic
1143865119 17:9917860-9917882 TGGGCAGGTGCTCTGGCCTGGGG - Intronic
1144236204 17:13262785-13262807 TGCTCAGAAGGGCTGGCCTGAGG - Intergenic
1144937105 17:18908661-18908683 TGGCCAGCAGCTCTGGCTTGGGG - Intronic
1145193325 17:20866858-20866880 TGGCCAGGAACTGGGGCCTGGGG + Intronic
1145298695 17:21614223-21614245 TGGCCAGGAACTGGGGCCTGGGG - Intergenic
1145351584 17:22089067-22089089 TGGCCAGGAACTGGGGCCTGGGG + Intergenic
1145403744 17:22568872-22568894 TGGCCAGGAACTGGGGCCTGGGG + Intergenic
1145723180 17:27090959-27090981 TGGCCAGGAACTGGGGCCTGGGG - Intergenic
1145745961 17:27319886-27319908 ATGGCAGTAGCTCTGGCCTGGGG + Intergenic
1145797750 17:27665772-27665794 AGCACAGAAGCCCTGGCCTGGGG - Intergenic
1146258645 17:31406401-31406423 TGGCCAGAGGCACTGGCTTTGGG + Intronic
1146945073 17:36868016-36868038 TGGCCAGCAGCTCTGGCTTAGGG - Intergenic
1147128630 17:38391992-38392014 TGCCCAGGACCTCTGGCATGAGG + Intronic
1147459288 17:40558055-40558077 TTTCCAGAAGCTCAGGCCAGAGG - Intronic
1149301099 17:55305236-55305258 TTGACAGGAGCCCTGGCCTGTGG + Intronic
1149777884 17:59372233-59372255 TTCCCAGAAGCCCTAGCCTGGGG + Intronic
1151460166 17:74249623-74249645 TGTCCAGGAGCTCTGGGGTGGGG + Intronic
1151508846 17:74546073-74546095 AAGCCAGAAGCTGTGGGCTGTGG - Exonic
1151564218 17:74888616-74888638 TGGACCGGAGCTCTGCCCTGGGG - Intronic
1151599281 17:75096383-75096405 AGGCCAGAGTCTCTGGCGTGAGG + Intronic
1152020717 17:77778994-77779016 TGCCCAGGAGCCCTGGCATGGGG + Intergenic
1152588577 17:81200032-81200054 TGGCCAACAGTTCTGGCGTGGGG + Intronic
1152663831 17:81555820-81555842 TGGCCAGAACTTCTGACCTCAGG + Intergenic
1152858147 17:82677870-82677892 TGTCCAGACGTTCTGGGCTGTGG - Intronic
1152913362 17:83018644-83018666 TGGTCAGAAGCAATGTCCTGTGG - Intronic
1153559619 18:6358824-6358846 TGAGCAGAAGCACTGGCCTGAGG + Intronic
1154343465 18:13523626-13523648 TGGGGAGACGCTCTGGCCAGTGG - Intronic
1154415836 18:14174787-14174809 TGGCCAGAAACTGGGGCCTGGGG + Intergenic
1154450677 18:14473481-14473503 TGGCCAGAAGTTCTGCCGAGTGG + Intergenic
1155533561 18:26792340-26792362 TGGCCAGAAAATGTGGCCTCTGG + Intergenic
1156483196 18:37448889-37448911 TGGCCAGTGGCTGTGGCGTGTGG - Intronic
1157166136 18:45359816-45359838 TGGACAGAAGCCCTTGCCGGTGG - Intronic
1158587770 18:58756267-58756289 CAGCCAGCAGCACTGGCCTGGGG - Intergenic
1160146249 18:76367486-76367508 TGGGCAGAGGCTCGGGCCTGGGG - Intronic
1160361753 18:78288992-78289014 TTGCCAGACACTATGGCCTGAGG + Intergenic
1160370214 18:78365789-78365811 TGGCCAGGAGGTGTGGACTGTGG + Intergenic
1160443715 18:78911946-78911968 TGGCCTGGGGCTGTGGCCTGAGG - Intergenic
1161041085 19:2111124-2111146 TGGGCAGCACCTCTGGCTTGGGG - Intronic
1161242090 19:3228320-3228342 TGGCCTGAGCCCCTGGCCTGGGG - Intronic
1161340713 19:3740546-3740568 TGGCCAGCTGCTCCGCCCTGGGG - Exonic
1161358323 19:3831991-3832013 TGGCCCAAGGCTCTGGCCTCTGG - Intronic
1161519540 19:4716054-4716076 TTGCCAGAAGCCCTGTCCTCCGG + Intronic
1162351086 19:10150164-10150186 TGGCCAGATGCTGTGGCCAAGGG + Intronic
1162947422 19:14052266-14052288 AGGCCAGAACCTGTGGCCTGGGG - Exonic
1163369293 19:16893188-16893210 GGCTCAGAAGCCCTGGCCTGTGG + Exonic
1163455943 19:17405695-17405717 TGACCAGCAGCTCTTGCATGAGG + Intergenic
1163863264 19:19753490-19753512 TGGCCAGAATATCTGGTCAGTGG - Intergenic
925905281 2:8536389-8536411 GGGCCAGAGGCACTGGCCGGAGG - Intergenic
926207681 2:10845780-10845802 TGGGGAGAAGCTCTAGGCTGGGG + Intergenic
926260639 2:11257243-11257265 TGGCCACAAGCTCTTCTCTGAGG - Intronic
926840491 2:17074339-17074361 TGGCCAGATGCTCTGACTTCTGG - Intergenic
927642472 2:24854083-24854105 TGTCTTGAAGCTGTGGCCTGTGG + Intronic
931344637 2:61434442-61434464 TGGCCAGGAGCACAGGCATGTGG - Intronic
934501298 2:94862042-94862064 TGGCCAGAAGCTCTGGCCTGCGG - Intergenic
935331209 2:101979183-101979205 TGGACTGAAGGTCTGGCCTGTGG + Intergenic
937348042 2:121139715-121139737 TGGCCAGGTGCTTTGGCCAGTGG + Intergenic
937983031 2:127625933-127625955 TGTCCATACACTCTGGCCTGGGG - Intronic
938121989 2:128640488-128640510 TGGTCAGAAGCCCAGGCCTCTGG - Intergenic
940060480 2:149560098-149560120 TGGCAAGAAGTTCTGGCTAGTGG - Intergenic
942202224 2:173582841-173582863 TGGCCAGAGCCTCTGCCCTCTGG + Intergenic
942299968 2:174551822-174551844 TGGGAAGAAACTATGGCCTGGGG - Intergenic
943692111 2:190880339-190880361 TCGCCAGACGCCCTGACCTGGGG + Intergenic
944403544 2:199356063-199356085 TTTCCAGAATCTCTGGCCTATGG + Intronic
946192680 2:218015803-218015825 TCCCCAGATGCTCTGGCCTGTGG - Intergenic
946423123 2:219576086-219576108 TGGCCAGAGACTGTGGCCTTTGG + Intergenic
946492692 2:220165350-220165372 TGGGCAGCTGCTCTGGCCTGAGG + Intergenic
946908574 2:224439049-224439071 TGGCTAAATGCTCTGGCCTCTGG + Intergenic
947531979 2:230915085-230915107 TGGGCAGAGGCACTAGCCTGGGG - Intronic
947578616 2:231296626-231296648 TGGCGAGAGTCTCTGGCGTGAGG + Intronic
947864235 2:233384987-233385009 TGGCCAGGAGCTCAGACCAGAGG - Intronic
948097404 2:235347327-235347349 GGGCCAGAGACGCTGGCCTGGGG - Intergenic
948423972 2:237876451-237876473 TGGGCAGAGGATGTGGCCTGGGG + Intronic
948464564 2:238145987-238146009 TGGTCAGGAGCCCTGGCCTGTGG - Intronic
948530080 2:238598616-238598638 TGTCCAGGGGCTCTGGCCTTTGG + Intergenic
948835481 2:240624193-240624215 TGGCCACAGGGTCTGGCCTCTGG - Intronic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1168862382 20:1055083-1055105 TGGCCAGCATCTCTAGGCTGGGG + Intergenic
1168979303 20:1991334-1991356 TGGCCAGCCGCTCTGGCCAGTGG + Intronic
1170571355 20:17634580-17634602 AGTCCAGAAGCTCTGGCTGGTGG - Intronic
1170658122 20:18309613-18309635 TAGCCAGAGGCTCAGCCCTGTGG + Intronic
1171089848 20:22274223-22274245 TGGCCAGCTGCTCTTCCCTGTGG - Intergenic
1171561887 20:26134352-26134374 TGGCCAGGAACTGGGGCCTGGGG + Intergenic
1171892505 20:30728840-30728862 TGGCCAGAAGCTCCAGCCTGCGG - Intergenic
1172024949 20:31942164-31942186 TGGCCACTAGTTCTGACCTGTGG - Intronic
1172378396 20:34465919-34465941 TATCCAGAAGCTCTAGCCAGAGG - Intronic
1173653571 20:44683431-44683453 TGGGCAGGAGTTCTGGCCTCTGG - Intergenic
1173810517 20:45952469-45952491 AGTCCAGATGCTCTGGCCTCTGG - Exonic
1174456120 20:50649857-50649879 GCGCCAAAAGCCCTGGCCTGGGG + Intronic
1175353708 20:58345527-58345549 TGGTCAGCACCCCTGGCCTGTGG - Intronic
1175985282 20:62761347-62761369 TGGCCGGCAGCCCTGGGCTGAGG + Exonic
1176649423 21:9531282-9531304 TGGCCAGGAACTGGGGCCTGGGG - Intergenic
1178342956 21:31801580-31801602 GGGACAGAAGCTCTGGGCTCAGG - Intergenic
1179219752 21:39395761-39395783 AGGCCAGGAGCTCTGCACTGCGG + Intronic
1179899670 21:44382933-44382955 TGGTCAGAAACCCTGGCCAGAGG + Intronic
1179935908 21:44603172-44603194 TGGCCTGAAACTCTGGCGTGGGG + Intronic
1179951012 21:44708839-44708861 TGGGCAGGGGCCCTGGCCTGTGG + Intronic
1180063872 21:45403305-45403327 TGGCCTGATGCACTGCCCTGGGG - Intergenic
1180128909 21:45812606-45812628 TGGCCAGAACTGCTGGCCTCAGG + Intronic
1181025541 22:20125393-20125415 TGGCCAGCAGCTCTGGCTTGGGG - Exonic
1181312046 22:21950158-21950180 TGGCCACCAGCTCTGGGCTTTGG + Intronic
1181619829 22:24083199-24083221 TGGGCAGAAGAGATGGCCTGAGG - Intronic
1182086407 22:27564069-27564091 TGGCCACGAACTCTGGCCAGGGG - Intergenic
1182452339 22:30428997-30429019 TGGCCAGAGAATCTGTCCTGAGG - Exonic
1182504486 22:30772058-30772080 TGGCCTGATTCTCTGGCTTGCGG - Intronic
1182685561 22:32120114-32120136 TGGCCAGGAACTGGGGCCTGGGG + Intergenic
1183022249 22:35036711-35036733 TGCCCATTAGCCCTGGCCTGTGG - Intergenic
1183089471 22:35511523-35511545 CTACCAGAAGCTCTGGACTGTGG - Intergenic
1183384965 22:37509441-37509463 TTGCCTGAAGCTCTGAGCTGAGG - Intronic
1184238588 22:43199809-43199831 TGGGGAGAGGCTCTGGCATGGGG + Exonic
1184452212 22:44590083-44590105 GGCCCAGAAGGTCTGGCCTGAGG - Intergenic
1185335552 22:50269629-50269651 GGGCCAGAGGACCTGGCCTGGGG - Intronic
949095276 3:78246-78268 CAGCCAGAAGCTCAGGTCTGAGG - Intergenic
949435888 3:4028918-4028940 TGGCCTGAATCTCTGGACTCTGG - Intronic
953080141 3:39608965-39608987 GGGCCAGAAGCTCTAGCCAGGGG + Intergenic
953432879 3:42854188-42854210 TGACAAGAAGCTCTGGGCTGGGG + Intronic
953710276 3:45264136-45264158 TGCCCACCAGCTCTGGCCAGAGG - Intergenic
953724815 3:45388657-45388679 TGCTCACAGGCTCTGGCCTGCGG - Exonic
953843312 3:46407075-46407097 TGCCAAGACGCTCTGGCTTGTGG - Intergenic
954301188 3:49701651-49701673 TGGCCAGATGCCCAGGCCAGGGG - Intronic
954328180 3:49875007-49875029 TGTCCAGCATCTTTGGCCTGAGG + Intergenic
954640018 3:52092274-52092296 AGGCCAGAAGCTCTTGCCCAGGG - Intronic
954706843 3:52485516-52485538 TGGCGAGAGGCTCTGGCCCTAGG + Intronic
955081809 3:55664708-55664730 TCGCCTGAAGCTCTGGGCCGCGG - Intronic
955378787 3:58419998-58420020 TGCCCAGGATCTCTGGCCTTAGG + Intronic
956900416 3:73709563-73709585 TGTGCAGAAGCTCTGGGCAGAGG - Intergenic
958168050 3:89902548-89902570 TCTCCAGAAGGACTGGCCTGAGG + Intergenic
961168065 3:124777204-124777226 TGGCCAGCAGCTCTGGCCTTGGG - Intronic
962375457 3:134855323-134855345 AGGCCAGAGGCTTTGGACTGGGG + Intronic
962852449 3:139318255-139318277 TGGACAGGCCCTCTGGCCTGTGG - Intronic
962874609 3:139526308-139526330 TGCACAGAAGCTCTGTCATGGGG + Intronic
967247563 3:187503345-187503367 TCACCACAACCTCTGGCCTGTGG + Intergenic
967813608 3:193780991-193781013 AGGCCAGAAGTTCAGGCCCGAGG - Intergenic
967867284 3:194200743-194200765 TGGCCAAATGCAGTGGCCTGAGG + Intergenic
968720435 4:2198629-2198651 TGTCCAGATGCCCCGGCCTGTGG - Exonic
969230529 4:5827198-5827220 TGGTCTGAAGCTGAGGCCTGCGG - Intronic
969315868 4:6381044-6381066 TGGCCAGCAGCTCTCCCGTGTGG + Exonic
969714494 4:8861685-8861707 AGGCCCACAGCTCTGGCCTGGGG + Intronic
970539746 4:17065521-17065543 TGGGTAGAAGCTGTGGCCTCTGG + Intergenic
972994083 4:44858023-44858045 TGGGCAGAAGTTCTGGCTAGAGG + Intergenic
973619878 4:52715549-52715571 TGGCAACGTGCTCTGGCCTGCGG + Intergenic
974615292 4:64272060-64272082 TGGCCACAAGCTCCGGCTTGGGG - Intergenic
977971328 4:103217624-103217646 TGGCCAGAATCTATTGACTGAGG + Intergenic
980002521 4:127507108-127507130 TCCCCAGAAGCTCTGCCCTTTGG - Intergenic
985591400 5:767204-767226 TGGGCAGAGGACCTGGCCTGTGG + Intergenic
985624861 5:980060-980082 TGGCCAGGAGCTCTTGGCTGAGG - Intronic
985795815 5:1961579-1961601 TCCCCAGAGGCTCTGGGCTGTGG - Intergenic
985863950 5:2496856-2496878 TGGCCAGAAATTCTGCCCTGTGG + Intergenic
986130099 5:4922120-4922142 TGGCCCGAAGCTCAATCCTGTGG + Intergenic
986238056 5:5930464-5930486 TGCCCAGCGCCTCTGGCCTGAGG - Intergenic
986645212 5:9910545-9910567 TGCCCCGGATCTCTGGCCTGTGG + Intergenic
988684907 5:33516742-33516764 TGCTCAGAACCTCTGGCCAGAGG + Intergenic
988753311 5:34215451-34215473 AGGCCAGAACCACAGGCCTGTGG - Intergenic
989368292 5:40679977-40679999 CTGCCAGAGGCTCTGGCCTGGGG - Exonic
990463601 5:56051951-56051973 TGGCAAGAAGGTCAAGCCTGAGG + Intergenic
990515747 5:56529666-56529688 TTGTCAGAGGCTCTGGGCTGAGG + Intronic
991327695 5:65455324-65455346 TGGCCTCAAGCTCTGACCTCAGG - Intronic
991741092 5:69676298-69676320 AGGCCAGAACCACAGGCCTGTGG - Intergenic
991756526 5:69878144-69878166 AGGCCAGAACCACAGGCCTGTGG + Intergenic
991792666 5:70256035-70256057 AGGCCAGAACCACAGGCCTGTGG - Intergenic
991820552 5:70552371-70552393 AGGCCAGAACCACAGGCCTGTGG - Intergenic
991835928 5:70754057-70754079 AGGCCAGAACCACAGGCCTGTGG + Intergenic
991885116 5:71256343-71256365 AGGCCAGAACCACAGGCCTGTGG - Intergenic
992115433 5:73534596-73534618 TGGCCAGAACCACTGGTCAGTGG + Intergenic
994830290 5:104773534-104773556 CTGCCAGAAGCTCTGCCCTCTGG + Intergenic
996707553 5:126512828-126512850 GGGACAGAAGCTCTGGCCCTTGG - Intergenic
997376332 5:133400279-133400301 AGGACACAAACTCTGGCCTGGGG - Intronic
998007769 5:138668456-138668478 TGGCCACAAAGACTGGCCTGAGG - Intronic
998046498 5:138991172-138991194 TGGCCAGATGCTCTGGATGGAGG + Intronic
999460335 5:151752250-151752272 TGGTCAGCAGGTCTGGGCTGGGG + Intronic
999653833 5:153793753-153793775 TGGCCAGAAACTCCTGCCTTGGG + Intronic
999702398 5:154239840-154239862 TGAGCAGAAGGTCTGGCATGTGG - Intronic
1003232162 6:4264224-4264246 AGGACAGAAGCTCTAGCCTGGGG + Intergenic
1003443541 6:6164914-6164936 AGTGCAGAAGCTCCGGCCTGTGG - Intronic
1004691151 6:17993096-17993118 TGGCTAGAGGCCCTGGACTGGGG + Intergenic
1005551480 6:26922274-26922296 AGGCCAGAACCACAGGCCTGTGG - Intergenic
1006170078 6:32087491-32087513 TGCCCAGCACCTCTGGCTTGGGG + Intronic
1006874228 6:37281530-37281552 TGGTGAGAAGCTCTGGCCTAAGG - Intronic
1007464450 6:42042090-42042112 GGTCCACAAGCTCTGGCCTGTGG - Intronic
1007697112 6:43740862-43740884 TTCCCAGAAGCTGTGTCCTGGGG - Intergenic
1007761135 6:44134430-44134452 TGGATGGAAGCTCTGGCCTCTGG - Intronic
1008237313 6:49065790-49065812 TTACCATCAGCTCTGGCCTGTGG - Intergenic
1008303367 6:49870473-49870495 TTGCAAGAAGCTGTGGCCTCAGG + Intronic
1010619551 6:78057276-78057298 TGTGCAGAAGCTCTTGCTTGTGG + Intergenic
1011986753 6:93456938-93456960 TAGCCAGAGGCTCTGGAATGTGG + Intergenic
1013172350 6:107648117-107648139 TGGCAAGTAGCTTTGACCTGTGG - Intronic
1013667005 6:112359364-112359386 GGGCTAGCAGGTCTGGCCTGTGG - Intergenic
1018697120 6:166398904-166398926 TGTCCAGAAGCTCCTGCTTGTGG + Intergenic
1019149410 6:169994176-169994198 TGGCCAGAAGCTCCAGCCATGGG + Intergenic
1019381845 7:727842-727864 TGGACAGAAGCGCTGGCTCGTGG - Intronic
1019713412 7:2527598-2527620 TGACCACAAGCTCTGTGCTGGGG + Exonic
1019715338 7:2536223-2536245 TGGCTCTCAGCTCTGGCCTGGGG - Intergenic
1019741480 7:2676917-2676939 TGGCTCTCAGCTCTGGCCTGGGG + Intergenic
1020090106 7:5333959-5333981 TGGACACCAGCTCTGACCTGGGG - Intronic
1020357359 7:7292116-7292138 TGGCCAGCAGCTGTGGGATGAGG + Intergenic
1020468792 7:8511951-8511973 TGCCCAGTAGCTCTGGCCCTTGG + Intronic
1022327475 7:29345095-29345117 AGGCCACATGCTCTGGCTTGGGG + Intronic
1022967149 7:35484331-35484353 TGGCCACAGGCTATGGGCTGTGG + Intergenic
1023023112 7:36028366-36028388 AGCCCAGGTGCTCTGGCCTGAGG - Intergenic
1023517953 7:41020975-41020997 TGGACAGGAGATGTGGCCTGTGG + Intergenic
1023672134 7:42588163-42588185 TGGCCTGAAGCTCTCACCAGAGG + Intergenic
1023865245 7:44235286-44235308 TGCCCAGCAGCCCTGGCCTTGGG + Intronic
1024569960 7:50715168-50715190 TGGCCTGGAGCTCCAGCCTGGGG + Intronic
1025275986 7:57581341-57581363 TGGCCAGGACCTGGGGCCTGGGG - Intergenic
1025635799 7:63318117-63318139 TGGCCAGAAACTAGGGCCTGGGG + Intergenic
1025646897 7:63430063-63430085 TGGCCAGAAACTAGGGCCTGGGG - Intergenic
1025809145 7:64863204-64863226 TGGCCAGAAGCTCAGGCCCCGGG + Intergenic
1029113141 7:98223561-98223583 AGGCCAGGAGATCTGGCCCGGGG + Intronic
1031120960 7:117721269-117721291 TGCCCAGAGCCTCTGTCCTGGGG - Intronic
1032699208 7:134363996-134364018 TGGCCAGAAGCTGTGGTCTTGGG - Intergenic
1033502553 7:141966342-141966364 TGGCCAGAAGTTCTGGCCTCTGG + Intronic
1034044747 7:147916028-147916050 AGGGCAGAAGCCCTTGCCTGAGG - Intronic
1034270265 7:149800281-149800303 TGGGGCGACGCTCTGGCCTGTGG - Intergenic
1034393884 7:150805215-150805237 GGGCCAGCAACTCTAGCCTGAGG - Intergenic
1034553684 7:151836701-151836723 AGCCCAGGAGCTGTGGCCTGAGG - Intronic
1034958182 7:155348955-155348977 TGGCCAGAGGTCCTGGCATGGGG - Intergenic
1034988375 7:155531870-155531892 TGGCCAGAGGCTCAGGGCTTAGG - Intronic
1035606898 8:935345-935367 TGGACAGACCCTCTGGACTGAGG - Intergenic
1035681345 8:1490737-1490759 TGAGCAGAATCTCTGGGCTGGGG + Intergenic
1037857772 8:22383951-22383973 TGGTCAGCAGCCCGGGCCTGGGG - Intronic
1037902446 8:22695583-22695605 TAGCCAGCGGCTCTGGCCTCTGG + Intergenic
1038493722 8:27987458-27987480 GGGGCACAAGATCTGGCCTGGGG - Intronic
1038977327 8:32714865-32714887 TGGCCTGAAGCTCATGCTTGGGG - Intronic
1039388926 8:37161466-37161488 TGGCCAGATGCTGAGGCCTCGGG - Intergenic
1039407989 8:37329162-37329184 TGGCAGGGAGCTCTGGGCTGGGG - Intergenic
1040372893 8:46794672-46794694 GGGCCAAAAGCGCTGGGCTGAGG + Intergenic
1040670394 8:49682775-49682797 TGGCCATAAGCTTTCACCTGAGG + Intergenic
1045407308 8:101879939-101879961 TGGCAGGCAGCTCTGCCCTGCGG - Intronic
1045491674 8:102674903-102674925 TGGCGAGATGCTCTGTGCTGTGG + Intergenic
1046379438 8:113433595-113433617 TGGAAAGACGCTCTGGCGTGGGG + Intronic
1048068637 8:130999094-130999116 TGGACACAAGCTCTGCCCTGGGG - Intronic
1049114877 8:140677363-140677385 GGGACAGAAGTTCTGGGCTGTGG - Intronic
1049204622 8:141357986-141358008 TGGCCTTAAGCCCTGCCCTGAGG + Intronic
1049269634 8:141687475-141687497 TGGCAAGATGCTCTGGTGTGAGG - Intergenic
1049503735 8:142983466-142983488 TGGGGACAAGCTCTGGCCTTGGG - Intergenic
1049587531 8:143438964-143438986 TGGCCAGGAGCTCGGGCAGGTGG - Intronic
1054356317 9:64066895-64066917 TGGCCAAAAGCTCCAGCCTGGGG + Intergenic
1055722327 9:79189595-79189617 TGGCCAGGAGCCCTGGCTTCTGG + Intergenic
1056281539 9:85045766-85045788 TGACCAGGAGCTCTGGGATGTGG - Intergenic
1056587406 9:87937798-87937820 TGGCCAGGAACTGGGGCCTGGGG + Intergenic
1056609470 9:88115144-88115166 TGGCCAGGAACTGGGGCCTGGGG - Intergenic
1056718946 9:89057051-89057073 TGGCCAGCTGCTCTGGAATGTGG - Intronic
1056953982 9:91067776-91067798 TGCCCTGAAACCCTGGCCTGGGG + Intergenic
1059116295 9:111602902-111602924 TCCCAAGAAGTTCTGGCCTGGGG + Intergenic
1059959572 9:119551885-119551907 GGGCCAGTAGCTATGGCTTGGGG - Intergenic
1060153275 9:121302016-121302038 TGGCCTGCAGATCTGGCGTGTGG + Exonic
1060566660 9:124598899-124598921 TGGCCAGCAGCTCTGGCTTGGGG + Intronic
1060764604 9:126284166-126284188 TGGACAGTTGCTCTGGCGTGGGG - Intergenic
1061488829 9:130934138-130934160 TCCCCTGAGGCTCTGGCCTGAGG - Intronic
1061617523 9:131790152-131790174 AGGTCAGACACTCTGGCCTGTGG + Intergenic
1061972022 9:134050106-134050128 TGGCCAGAAGCCCTGGCCAAAGG - Intronic
1062665826 9:137670930-137670952 TGGCCACACCCTCTGGCCTGTGG + Intronic
1203561869 Un_KI270744v1:64360-64382 TGGCCAGAAGCTCCAGCCTGCGG - Intergenic
1203627164 Un_KI270750v1:34830-34852 TGGCCAGGAACTGGGGCCTGGGG - Intergenic
1188064790 X:25645910-25645932 TGGCCAGCAGCTCTGGCTTGGGG + Intergenic
1189873127 X:45404976-45404998 TGGCCAGGAGCTGTGGGGTGGGG - Intergenic
1190296488 X:49030490-49030512 TGTCCAGCTGCTCTGGCTTGAGG + Exonic
1190397909 X:50003435-50003457 AGGCAAGAGGCACTGGCCTGGGG - Intronic
1192292856 X:69815685-69815707 TGCCCAGAAGCTCTGTCCCAGGG - Intronic
1192723800 X:73727024-73727046 AGCCCTGAAGATCTGGCCTGGGG + Intergenic
1195134126 X:101886577-101886599 TGACTAGAAGCTCTGGTCTTTGG + Intronic
1199742146 X:150745623-150745645 TCCCCAGCAGCTCTGCCCTGAGG + Intronic
1200062356 X:153489184-153489206 GGGCCAGGAGCTCAGGGCTGGGG + Intronic