ID: 934504307

View in Genome Browser
Species Human (GRCh38)
Location 2:94879267-94879289
Sequence CCCAGTAACAGGTTGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 5, 3: 5, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934504296_934504307 9 Left 934504296 2:94879235-94879257 CCTGAGGGTCCCTGCGCCCACTG 0: 1
1: 1
2: 4
3: 25
4: 185
Right 934504307 2:94879267-94879289 CCCAGTAACAGGTTGATGCAGGG 0: 1
1: 0
2: 5
3: 5
4: 106
934504298_934504307 -1 Left 934504298 2:94879245-94879267 CCTGCGCCCACTGTGCTCCCACC 0: 2
1: 2
2: 5
3: 24
4: 368
Right 934504307 2:94879267-94879289 CCCAGTAACAGGTTGATGCAGGG 0: 1
1: 0
2: 5
3: 5
4: 106
934504297_934504307 0 Left 934504297 2:94879244-94879266 CCCTGCGCCCACTGTGCTCCCAC 0: 3
1: 1
2: 5
3: 14
4: 246
Right 934504307 2:94879267-94879289 CCCAGTAACAGGTTGATGCAGGG 0: 1
1: 0
2: 5
3: 5
4: 106
934504299_934504307 -7 Left 934504299 2:94879251-94879273 CCCACTGTGCTCCCACCCCAGTA 0: 1
1: 0
2: 6
3: 25
4: 241
Right 934504307 2:94879267-94879289 CCCAGTAACAGGTTGATGCAGGG 0: 1
1: 0
2: 5
3: 5
4: 106
934504300_934504307 -8 Left 934504300 2:94879252-94879274 CCACTGTGCTCCCACCCCAGTAA 0: 1
1: 0
2: 6
3: 33
4: 377
Right 934504307 2:94879267-94879289 CCCAGTAACAGGTTGATGCAGGG 0: 1
1: 0
2: 5
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934504307 Original CRISPR CCCAGTAACAGGTTGATGCA GGG Intergenic
908785303 1:67729542-67729564 CTGAGTGAAAGGTTGATGCAGGG - Intronic
912905213 1:113698783-113698805 CCCAGTAAGAGATAGATGCTAGG - Intronic
916863544 1:168832363-168832385 CCCAGTGACAGGTTAATGGCAGG - Intergenic
922116583 1:222618746-222618768 CCCAGTGGCAGGTTGATGGTGGG + Intronic
1063402819 10:5763903-5763925 CCGAGTAACAGGTTAAAGAATGG + Intergenic
1066476928 10:35756861-35756883 CCCAGAAACAGGGTGAAGCCAGG - Intergenic
1067076659 10:43191164-43191186 ACAAGAAACAGGTTGAGGCATGG - Intergenic
1067327472 10:45283227-45283249 CCCAGCAACAGGCTGCAGCATGG + Intergenic
1068455712 10:57251107-57251129 TTCAGTAACTGGTTGATTCAGGG - Intergenic
1069827221 10:71261735-71261757 GCCAGTAAGAGGCAGATGCAGGG - Intronic
1073480463 10:103783368-103783390 CCAGGTGACAGGTTGATGCGGGG + Intronic
1074277991 10:112023299-112023321 TCCAATAACTGGTAGATGCAGGG + Intergenic
1075155479 10:119973073-119973095 ACCAGTAACAGCTTGAGGCCAGG - Intergenic
1078944052 11:16043885-16043907 TCCAATGACTGGTTGATGCAGGG + Intronic
1079164511 11:18026706-18026728 CCAAGTAACACGTTGATGGAAGG + Intronic
1079698691 11:23517529-23517551 CCCAGTGACAGCATGATGCAGGG - Intergenic
1080604835 11:33856512-33856534 CACAGTAACACATTCATGCAAGG + Intergenic
1080774515 11:35373185-35373207 CCCAGTCACAGGAAGAGGCAAGG + Intronic
1081600768 11:44492198-44492220 TCCAATGACTGGTTGATGCAGGG + Intergenic
1082864081 11:57882492-57882514 TCCAGTAAGAGGGAGATGCATGG + Intergenic
1085048968 11:73369917-73369939 CCCAGTAAAATGATGCTGCACGG - Intergenic
1086435076 11:86772087-86772109 CACAGTAACTGGTTGAAGGATGG + Intergenic
1088333173 11:108674204-108674226 CCCAGCTACAGGCTGAGGCAGGG + Intronic
1090081706 11:123617965-123617987 GCCGGTATCAGGTTGAGGCAGGG + Intronic
1090307338 11:125702682-125702704 CCCAGTAACAGCCTGGTGCCTGG + Intergenic
1090821407 11:130345607-130345629 CCCAGTAAGAGCTGGAGGCATGG - Intergenic
1091839906 12:3613474-3613496 CCCACTAATAGGATGAGGCAGGG - Intronic
1095627515 12:44333884-44333906 CCCATGAAGAGGTTGATGAAAGG + Intronic
1095814602 12:46407641-46407663 CCCAGTTACAGATTGAATCAGGG - Intergenic
1100833695 12:98544338-98544360 CCAAGGAAAAGGGTGATGCAAGG + Intronic
1101886490 12:108668010-108668032 CCCAGTAGCAAGTTGATGATGGG - Intronic
1106676281 13:31961951-31961973 CTGAGCAACAGGATGATGCAGGG - Intergenic
1110126441 13:71948800-71948822 CTCAGTAACAGGTTTAATCAAGG + Intergenic
1110499156 13:76205885-76205907 ACCAGTAACAGGTTAAAGTAAGG + Intergenic
1113132247 13:107051181-107051203 CCCAGAAACGGGTTGAGTCAAGG - Intergenic
1113848389 13:113404797-113404819 CCCAGAAACAGGTTCAGGAATGG - Intergenic
1118336612 14:64858680-64858702 CCCAGTAAAAGGCTGGTGCCTGG + Intronic
1122634078 14:103122201-103122223 CCCAGAGACAGGATGATGGATGG + Intergenic
1202902363 14_GL000194v1_random:51137-51159 CCCAGGGACAGGTTGATGCAGGG - Intergenic
1124697460 15:31876964-31876986 CCCACTAACAGGCTGAGACAGGG - Intergenic
1129157223 15:73725982-73726004 CCCTGGATCAGGTTGAAGCATGG - Intergenic
1129407824 15:75330749-75330771 ACCACTAACAGGGTGCTGCATGG + Intergenic
1129470992 15:75753526-75753548 ACCACTAACAGGGTGCTGCATGG + Intergenic
1130088540 15:80799542-80799564 CTCAGTAACAGGATTGTGCAGGG - Intronic
1135365865 16:21852035-21852057 CCGAGATACAGGTTGATGGACGG - Intronic
1136481318 16:30543747-30543769 TCCAGTTACAGGCTGAGGCAGGG + Intronic
1140854387 16:78965030-78965052 CCCAGCAAAAGTTTGCTGCATGG + Intronic
1146626082 17:34436513-34436535 CCCAGTAACCTGTTGAGACAGGG + Intergenic
1147177735 17:38666806-38666828 CCCCATAACAGGTTGCTGCTGGG + Intergenic
1152070366 17:78131180-78131202 CCCAGGCACAGGTGGATGCGGGG + Intronic
1152312740 17:79560791-79560813 CCCAGTGACAGGCTGAAGCTCGG - Intergenic
1156497629 18:37536486-37536508 CCCAGCTACAGGTCTATGCAGGG + Intronic
1161728130 19:5942401-5942423 CCCAGTCACAGGCTGAGGGAAGG + Intronic
1161897512 19:7093607-7093629 TCCAGTGACTGGTTGATGTAGGG + Intergenic
925556651 2:5138144-5138166 GCCAATAACTGTTTGATGCAGGG - Intergenic
932502390 2:72194854-72194876 GCCAGTAACAGGTTGGTTCCTGG + Intronic
933541940 2:83655512-83655534 CCCAATAATAAATTGATGCATGG + Intergenic
933900018 2:86842907-86842929 CCCAGGATCAGCTTGAGGCAGGG - Intronic
933990873 2:87633099-87633121 ACCAGGAACAGGTTCATGCCAGG - Intergenic
934504307 2:94879267-94879289 CCCAGTAACAGGTTGATGCAGGG + Intergenic
936302969 2:111317724-111317746 ACCAGGAACAGGTTCATGCCAGG + Intergenic
940992200 2:160109161-160109183 CCCACTAACAGCATGATGCCTGG + Intronic
941490628 2:166138621-166138643 CCCAGCAAAAGTTTGCTGCAGGG + Intergenic
944681751 2:202083826-202083848 CCCAGTGACATTTTGATACAAGG + Intronic
1171135180 20:22688996-22689018 CCCAGTGATGGGTGGATGCAAGG + Intergenic
1173946513 20:46955245-46955267 CCCAGCTACAGGCTGAGGCAGGG - Intronic
1175010411 20:55728884-55728906 CTAAGTAACAGGATGAGGCAGGG + Intergenic
1176621731 21:9065904-9065926 CCCAGGGACAGGTTGATGCAGGG - Intergenic
1178368951 21:32011202-32011224 ACCAGAAACAGGAAGATGCAAGG - Intronic
1179159882 21:38886063-38886085 CCCAGTGACAGCTTAAAGCAAGG - Intergenic
1181625900 22:24121896-24121918 CCCTGTAACAGGATGAGGAAGGG - Intronic
1184042760 22:41953692-41953714 TCCAGGGACAGGATGATGCAGGG - Intergenic
950828396 3:15849939-15849961 CCAAGTAAGAGGTTAAAGCAGGG + Intronic
959893654 3:111583541-111583563 CCCAGCAAAAGTTTGCTGCAAGG - Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963327898 3:143881977-143881999 CACAGTCACAGTGTGATGCAGGG + Intergenic
971149185 4:24013034-24013056 CCCTGTAACAGGTTGCTCCAGGG + Intergenic
975236956 4:72010079-72010101 CCCAATAACAAGGTGAAGCAGGG - Intergenic
980083594 4:128369170-128369192 CCCAGAAAAAGTTTGCTGCAAGG - Intergenic
986028120 5:3870187-3870209 CCCATTAACATCTTTATGCACGG - Intergenic
993271895 5:85807621-85807643 CCCAGCTACAGGCTGAGGCAGGG - Intergenic
999980407 5:156952328-156952350 CCCAGTAAAAGATTTAGGCAGGG - Intronic
1000500467 5:162042470-162042492 CCCAGTAATTGGTTTAAGCATGG - Intergenic
1006403133 6:33829452-33829474 CCCAGTGAAAGCCTGATGCAGGG + Intergenic
1007815293 6:44519239-44519261 CCCAGAACCAGGTGGATCCACGG - Intergenic
1015468616 6:133576739-133576761 ACCAGAAACAAGTTGATGTACGG - Intergenic
1018499233 6:164386292-164386314 CCCAGGAACAGGCTCATGCATGG - Intergenic
1019873931 7:3792158-3792180 CCCAGTTTAAGGTTAATGCAAGG - Intronic
1023806365 7:43875705-43875727 CCCAGTAACAGCCTGAAGAATGG + Intronic
1024237304 7:47408238-47408260 CCCAGGAACAGGGTGGGGCAGGG - Intronic
1030808497 7:113945941-113945963 CCCAGTACCAGTCTGAAGCATGG + Intronic
1031295195 7:119993134-119993156 CCCAGGAACAGATGGATTCATGG + Intergenic
1033355689 7:140597731-140597753 CCCAGGGACAGGTTGATTCTGGG - Intronic
1034697812 7:153069585-153069607 CCCAATGATGGGTTGATGCAGGG - Intergenic
1035808794 8:2474157-2474179 CCCAGTAACAAGGTGATGTGGGG - Intergenic
1036911195 8:12758647-12758669 CCCATTAGGAGGTTGAGGCAGGG - Intergenic
1045740825 8:105357835-105357857 CCCAGTAACAGGCAGTGGCAGGG - Intronic
1049578379 8:143400022-143400044 CCCAGCAACGGGGTGATGCAGGG - Intergenic
1049987546 9:965779-965801 CCCAGGAGAAGGTTGGTGCAGGG + Intronic
1051099301 9:13502768-13502790 CACAATGATAGGTTGATGCAGGG + Intergenic
1051727275 9:20101277-20101299 CTCAGCAAAATGTTGATGCAGGG - Intergenic
1055562229 9:77532414-77532436 CCCAGCAGCAGGTGAATGCAGGG + Intronic
1056199658 9:84262811-84262833 CCCTTTAACAGGTTAAGGCAAGG + Intergenic
1056837548 9:89969273-89969295 CCCATTTACAGGTTTTTGCATGG - Intergenic
1203744918 Un_GL000218v1:36314-36336 CCCAGGGACAGGTTGATGCAGGG - Intergenic
1203565188 Un_KI270744v1:83170-83192 CCCAGGGACAGGTTGATGCAGGG + Intergenic
1192593030 X:72377005-72377027 TGCAATACCAGGTTGATGCATGG + Intronic
1193429085 X:81378042-81378064 CCTGTTAACATGTTGATGCAGGG + Intergenic
1194423616 X:93708445-93708467 CCTATTAAGAGGTTGATGTAAGG + Intronic
1200755695 Y:6988001-6988023 TCTAGGAACAGGTTTATGCATGG + Intronic
1201158253 Y:11151357-11151379 CCCAGGGACAGGTTGATGCAGGG - Intergenic
1201799801 Y:17942729-17942751 CCCAGCAACAGGCTGCAGCATGG - Intergenic
1201801752 Y:17963227-17963249 CCCAGCAACAGGCTGCAGCATGG + Intergenic
1202361734 Y:24117867-24117889 CCCAGCAACAGGCTGCAGCATGG + Intergenic
1202363338 Y:24135229-24135251 CCCAGCAACAGGCTGCAGCATGG - Intergenic
1202507442 Y:25534888-25534910 CCCAGCAACAGGCTGCAGCATGG + Intergenic
1202509043 Y:25552246-25552268 CCCAGCAACAGGCTGCAGCATGG - Intergenic