ID: 934506178

View in Genome Browser
Species Human (GRCh38)
Location 2:94896566-94896588
Sequence CTGCTTTCTGTTGTTCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934506178_934506183 15 Left 934506178 2:94896566-94896588 CCTCTGAGAACAACAGAAAGCAG No data
Right 934506183 2:94896604-94896626 GGAAAAGCCACAGAAGAGGCAGG No data
934506178_934506184 16 Left 934506178 2:94896566-94896588 CCTCTGAGAACAACAGAAAGCAG No data
Right 934506184 2:94896605-94896627 GAAAAGCCACAGAAGAGGCAGGG No data
934506178_934506182 11 Left 934506178 2:94896566-94896588 CCTCTGAGAACAACAGAAAGCAG No data
Right 934506182 2:94896600-94896622 AGAGGGAAAAGCCACAGAAGAGG No data
934506178_934506179 -7 Left 934506178 2:94896566-94896588 CCTCTGAGAACAACAGAAAGCAG No data
Right 934506179 2:94896582-94896604 AAAGCAGTACGTAGACCAAGAGG No data
934506178_934506180 -6 Left 934506178 2:94896566-94896588 CCTCTGAGAACAACAGAAAGCAG No data
Right 934506180 2:94896583-94896605 AAGCAGTACGTAGACCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934506178 Original CRISPR CTGCTTTCTGTTGTTCTCAG AGG (reversed) Intergenic
No off target data available for this crispr