ID: 934506180

View in Genome Browser
Species Human (GRCh38)
Location 2:94896583-94896605
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934506178_934506180 -6 Left 934506178 2:94896566-94896588 CCTCTGAGAACAACAGAAAGCAG No data
Right 934506180 2:94896583-94896605 AAGCAGTACGTAGACCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr