ID: 934508246

View in Genome Browser
Species Human (GRCh38)
Location 2:94914084-94914106
Sequence CTGGAGAGACAGAGGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934508246_934508252 11 Left 934508246 2:94914084-94914106 CCATGCACCCTCTGTCTCTCCAG No data
Right 934508252 2:94914118-94914140 CTCAACTCAAAAAGCCTTTGAGG No data
934508246_934508254 22 Left 934508246 2:94914084-94914106 CCATGCACCCTCTGTCTCTCCAG No data
Right 934508254 2:94914129-94914151 AAGCCTTTGAGGTTCTATTTGGG No data
934508246_934508253 21 Left 934508246 2:94914084-94914106 CCATGCACCCTCTGTCTCTCCAG No data
Right 934508253 2:94914128-94914150 AAAGCCTTTGAGGTTCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934508246 Original CRISPR CTGGAGAGACAGAGGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr