ID: 934508253

View in Genome Browser
Species Human (GRCh38)
Location 2:94914128-94914150
Sequence AAAGCCTTTGAGGTTCTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934508249_934508253 13 Left 934508249 2:94914092-94914114 CCTCTGTCTCTCCAGTCTCTGGT No data
Right 934508253 2:94914128-94914150 AAAGCCTTTGAGGTTCTATTTGG No data
934508247_934508253 14 Left 934508247 2:94914091-94914113 CCCTCTGTCTCTCCAGTCTCTGG No data
Right 934508253 2:94914128-94914150 AAAGCCTTTGAGGTTCTATTTGG No data
934508246_934508253 21 Left 934508246 2:94914084-94914106 CCATGCACCCTCTGTCTCTCCAG No data
Right 934508253 2:94914128-94914150 AAAGCCTTTGAGGTTCTATTTGG No data
934508250_934508253 2 Left 934508250 2:94914103-94914125 CCAGTCTCTGGTTTCCTCAACTC No data
Right 934508253 2:94914128-94914150 AAAGCCTTTGAGGTTCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934508253 Original CRISPR AAAGCCTTTGAGGTTCTATT TGG Intergenic
No off target data available for this crispr