ID: 934515586

View in Genome Browser
Species Human (GRCh38)
Location 2:94984480-94984502
Sequence TCTATGGATTTGCCCACTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934515586_934515589 4 Left 934515586 2:94984480-94984502 CCTAGAGTGGGCAAATCCATAGA No data
Right 934515589 2:94984507-94984529 GAAAGTAAATGGTAGTTGCCAGG No data
934515586_934515600 28 Left 934515586 2:94984480-94984502 CCTAGAGTGGGCAAATCCATAGA No data
Right 934515600 2:94984531-94984553 GCTCGGGGGAGGGAAGAATAGGG No data
934515586_934515597 18 Left 934515586 2:94984480-94984502 CCTAGAGTGGGCAAATCCATAGA No data
Right 934515597 2:94984521-94984543 GTTGCCAGGGGCTCGGGGGAGGG No data
934515586_934515596 17 Left 934515586 2:94984480-94984502 CCTAGAGTGGGCAAATCCATAGA No data
Right 934515596 2:94984520-94984542 AGTTGCCAGGGGCTCGGGGGAGG No data
934515586_934515595 14 Left 934515586 2:94984480-94984502 CCTAGAGTGGGCAAATCCATAGA No data
Right 934515595 2:94984517-94984539 GGTAGTTGCCAGGGGCTCGGGGG No data
934515586_934515591 6 Left 934515586 2:94984480-94984502 CCTAGAGTGGGCAAATCCATAGA No data
Right 934515591 2:94984509-94984531 AAGTAAATGGTAGTTGCCAGGGG No data
934515586_934515588 -7 Left 934515586 2:94984480-94984502 CCTAGAGTGGGCAAATCCATAGA No data
Right 934515588 2:94984496-94984518 CCATAGAGACAGAAAGTAAATGG No data
934515586_934515599 27 Left 934515586 2:94984480-94984502 CCTAGAGTGGGCAAATCCATAGA No data
Right 934515599 2:94984530-94984552 GGCTCGGGGGAGGGAAGAATAGG No data
934515586_934515592 11 Left 934515586 2:94984480-94984502 CCTAGAGTGGGCAAATCCATAGA No data
Right 934515592 2:94984514-94984536 AATGGTAGTTGCCAGGGGCTCGG 0: 34
1: 271
2: 1024
3: 2363
4: 4424
934515586_934515593 12 Left 934515586 2:94984480-94984502 CCTAGAGTGGGCAAATCCATAGA No data
Right 934515593 2:94984515-94984537 ATGGTAGTTGCCAGGGGCTCGGG No data
934515586_934515594 13 Left 934515586 2:94984480-94984502 CCTAGAGTGGGCAAATCCATAGA No data
Right 934515594 2:94984516-94984538 TGGTAGTTGCCAGGGGCTCGGGG No data
934515586_934515590 5 Left 934515586 2:94984480-94984502 CCTAGAGTGGGCAAATCCATAGA No data
Right 934515590 2:94984508-94984530 AAAGTAAATGGTAGTTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934515586 Original CRISPR TCTATGGATTTGCCCACTCT AGG (reversed) Intergenic
No off target data available for this crispr