ID: 934517062

View in Genome Browser
Species Human (GRCh38)
Location 2:94995326-94995348
Sequence GTGGATTCTCATAGTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934517062_934517070 -2 Left 934517062 2:94995326-94995348 CCCACAACACTATGAGAATCCAC No data
Right 934517070 2:94995347-94995369 ACAGGCAGGGGTTTGGCTCTTGG No data
934517062_934517068 -9 Left 934517062 2:94995326-94995348 CCCACAACACTATGAGAATCCAC No data
Right 934517068 2:94995340-94995362 AGAATCCACAGGCAGGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934517062 Original CRISPR GTGGATTCTCATAGTGTTGT GGG (reversed) Intergenic
No off target data available for this crispr