ID: 934520578

View in Genome Browser
Species Human (GRCh38)
Location 2:95017888-95017910
Sequence GGCTGCACACAGGGTCAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934520578_934520586 -2 Left 934520578 2:95017888-95017910 CCGCGCTGACCCTGTGTGCAGCC No data
Right 934520586 2:95017909-95017931 CCAACTCTGGGGAAGGCAGTAGG No data
934520578_934520588 16 Left 934520578 2:95017888-95017910 CCGCGCTGACCCTGTGTGCAGCC No data
Right 934520588 2:95017927-95017949 GTAGGCAGAAGAGAAAGCCAGGG No data
934520578_934520590 24 Left 934520578 2:95017888-95017910 CCGCGCTGACCCTGTGTGCAGCC No data
Right 934520590 2:95017935-95017957 AAGAGAAAGCCAGGGGCCCCAGG No data
934520578_934520587 15 Left 934520578 2:95017888-95017910 CCGCGCTGACCCTGTGTGCAGCC No data
Right 934520587 2:95017926-95017948 AGTAGGCAGAAGAGAAAGCCAGG No data
934520578_934520584 -9 Left 934520578 2:95017888-95017910 CCGCGCTGACCCTGTGTGCAGCC No data
Right 934520584 2:95017902-95017924 TGTGCAGCCAACTCTGGGGAAGG No data
934520578_934520589 17 Left 934520578 2:95017888-95017910 CCGCGCTGACCCTGTGTGCAGCC No data
Right 934520589 2:95017928-95017950 TAGGCAGAAGAGAAAGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934520578 Original CRISPR GGCTGCACACAGGGTCAGCG CGG (reversed) Intergenic
No off target data available for this crispr