ID: 934520750

View in Genome Browser
Species Human (GRCh38)
Location 2:95018779-95018801
Sequence TTTTTTAAGGGGTTTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934520742_934520750 -2 Left 934520742 2:95018758-95018780 CCAAGATTCTGACCTCTCTGATT No data
Right 934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG No data
934520741_934520750 8 Left 934520741 2:95018748-95018770 CCGGGTAGCGCCAAGATTCTGAC No data
Right 934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934520750 Original CRISPR TTTTTTAAGGGGTTTGGGGA AGG Intergenic
No off target data available for this crispr