ID: 934520877

View in Genome Browser
Species Human (GRCh38)
Location 2:95019397-95019419
Sequence AGCACTCATGGCCCTGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934520870_934520877 3 Left 934520870 2:95019371-95019393 CCGCCCTTTCTCCCTGTCCTTCA No data
Right 934520877 2:95019397-95019419 AGCACTCATGGCCCTGCCCATGG No data
934520873_934520877 -8 Left 934520873 2:95019382-95019404 CCCTGTCCTTCAAGAAGCACTCA No data
Right 934520877 2:95019397-95019419 AGCACTCATGGCCCTGCCCATGG No data
934520866_934520877 25 Left 934520866 2:95019349-95019371 CCTGCCTGTGAGCTCATTTTCCC No data
Right 934520877 2:95019397-95019419 AGCACTCATGGCCCTGCCCATGG No data
934520871_934520877 0 Left 934520871 2:95019374-95019396 CCCTTTCTCCCTGTCCTTCAAGA No data
Right 934520877 2:95019397-95019419 AGCACTCATGGCCCTGCCCATGG No data
934520874_934520877 -9 Left 934520874 2:95019383-95019405 CCTGTCCTTCAAGAAGCACTCAT No data
Right 934520877 2:95019397-95019419 AGCACTCATGGCCCTGCCCATGG No data
934520867_934520877 21 Left 934520867 2:95019353-95019375 CCTGTGAGCTCATTTTCCCCGCC No data
Right 934520877 2:95019397-95019419 AGCACTCATGGCCCTGCCCATGG No data
934520868_934520877 5 Left 934520868 2:95019369-95019391 CCCCGCCCTTTCTCCCTGTCCTT No data
Right 934520877 2:95019397-95019419 AGCACTCATGGCCCTGCCCATGG No data
934520869_934520877 4 Left 934520869 2:95019370-95019392 CCCGCCCTTTCTCCCTGTCCTTC No data
Right 934520877 2:95019397-95019419 AGCACTCATGGCCCTGCCCATGG No data
934520872_934520877 -1 Left 934520872 2:95019375-95019397 CCTTTCTCCCTGTCCTTCAAGAA No data
Right 934520877 2:95019397-95019419 AGCACTCATGGCCCTGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934520877 Original CRISPR AGCACTCATGGCCCTGCCCA TGG Intergenic
No off target data available for this crispr