ID: 934521002

View in Genome Browser
Species Human (GRCh38)
Location 2:95020201-95020223
Sequence CACTCTAAGGGGCGGGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934520988_934521002 3 Left 934520988 2:95020175-95020197 CCTGGTCGTCCACGAGGGAGTGA No data
Right 934521002 2:95020201-95020223 CACTCTAAGGGGCGGGGGGGGGG No data
934520989_934521002 -6 Left 934520989 2:95020184-95020206 CCACGAGGGAGTGACCTCACTCT No data
Right 934521002 2:95020201-95020223 CACTCTAAGGGGCGGGGGGGGGG No data
934520983_934521002 30 Left 934520983 2:95020148-95020170 CCAGGCGGCTTCTCTAGAAGGTG No data
Right 934521002 2:95020201-95020223 CACTCTAAGGGGCGGGGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934521002 Original CRISPR CACTCTAAGGGGCGGGGGGG GGG Intergenic
No off target data available for this crispr